Diplolepis californica

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Diplolepis

At a glance

Occurrence records222

Data sources5

Biological traits0

DNA specimens30

eDNA detections32

Sources5 archives

Databases and archives Diplolepis californica's data was compiled from.

GBIFGlobal Biodiversity Information Facility222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF222 records

Environmental DNA1 datasets · 1 countries32 detections

DNA & barcodingBOLD30 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplolepis californica has left across the world's sequence archives.

At a glance

DNA specimens30

BINs4

Marker genes1

eDNA detections32

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.88%

Haplotypes2

BINs4

Most divergent pair1.7%

Where individuals differ — all 17 variable positions, in barcode order

79Tmostly conserved

88Gmostly conserved

133Cvariable

235Cmostly conserved

331Gmostly conserved

343Tvariable

376Gmostly conserved

377Tmostly conserved

379Tmostly conserved

415Gvariable

433Gmostly conserved

434Gvariable

550Gmostly conserved

616Cmostly conserved

634Cmostly conserved

643Amostly conserved

646Cmostly conserved

AATTTTATATTTTATTTTAGGTGTATGATGTGGGGTAGTTGGGGCAGCATTAAGAATAATTATTCGGGTGGAACTTGGTACTGCAAGGCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplolepis radicumsame genus5.7%Diplolepis triformasame genus6.5%Diplolepis spinosasame genus6.6%Diplolepis oregonensissame genus8.4%Diplolepis mayrisame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type222 records

Wild obs. + sensor185

Museum / vouchered37

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 114≤1 km 9≤10 km 1>10 km 4

128 georeferenced · 57 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 21>10 km 1

22 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	14
Chicago, US	8
Cambridge, US	7
Natural History Museum of Utahlocation not on record	1

4 institutions · 30 of 37 vouchered records shown · 7 without an institution code

09Environmental DNA32 detections

Where the DNA of Diplolepis californica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 7.80–20.0

Seasonal swing summer↔winter17.0 °C

Max temp (day)26.7 °C 14.5–27.8

Min temp (night)12.1 °C 1.40–13.4

Precipitation14.9 mm/mo 13.8–121

Air humidity50.4 % 41.7–61.7

Moisture balance-126 mm/mo -133–75.4

Vapour deficit1,278 Pa 509–1,300

Wind speed2.80 m/s 1.30–3.40

Cloud cover12.8 % 12.4–54.5

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)