Diaphorodoris luteocincta

(M.Sars, 1870) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Calycidorididae/Diaphorodoris

At a glance

Occurrence records3 283

Data sources8

Biological traits2

DNA specimens44

eDNA detections37

Sources8 archives

Databases and archives Diaphorodoris luteocincta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 109 records↗

OBISOcean Biodiversity Information System1 174 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS3 283 records

Environmental DNA1 datasets · 4 countries37 detections

DNA & barcodingBOLD44 specimens

01Narrative

Diaphorodoris luteocincta is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Calycidorididae.Rosenberg, G.; Gofas, S. (2015). Diaphorodoris luteocincta (M. Sars, 1870). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-24.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphorodoris luteocincta has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections37

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

4Amostly conserved

46Tmostly conserved

49Tmostly conserved

55Gmostly conserved

95Cmostly conserved

97Tmostly conserved

115Cmostly conserved

136Cmostly conserved

139Gmostly conserved

166Amostly conserved

169Tmostly conserved

170Tmostly conserved

193Cmostly conserved

235Tmostly conserved

241Gmostly conserved

265Gvariable

271Tmostly conserved

274Cmostly conserved

284Tvariable

287Cvariable

295Tmostly conserved

331Amostly conserved

337Avariable

343Tvariable

346Gvariable

355Cmostly conserved

361Cvariable

370Tmostly conserved

374Amostly conserved

400Amostly conserved

406Cmostly conserved

442Cmostly conserved

463Cmostly conserved

466Gmostly conserved

472Gmostly conserved

481Gmostly conserved

487Amostly conserved

539Cmostly conserved

541Gvariable

542Tmostly conserved

547Amostly conserved

557Tmostly conserved

589Cmostly conserved

601Tmostly conserved

643Tmostly conserved

TACATTATATATTATTTTTGGTATATGATGTGGTTTATTAGGTACTGGTTTAAGGTTACTTATTCGTTTTGAATTAGGTACAGCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes13

BINs2

Most divergent pair6.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diaphorodoris lirulatocaudasame genus15.2%Calycidoris guentherisame family15.5%Idaliadoris neapolitanasame order16.1%Doriopsilla bertschisame order16.3%Doriopsilla areolatasame order16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 283 records

Wild obs. + sensor2 026

Museum / vouchered1 176

Other81

Range

Area of Occupancy AOO2 876 km²

Depth

0–200 m sunlit851

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17.1 m · max 94 m · 851 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 554≤1 km 114≤10 km 36>10 km 3

1 707 georeferenced · 319 without coordinates

Open the mapobservation + sensor2 026

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 48≤1 km 19≤10 km 9>10 km 2

78 georeferenced · 1 098 without coordinates

Open the institutions mapphysical evidence1 176

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bergen, NO	39
NTNU-VMlocation not on record	17
DASSHlocation not on record	10
University Museum of Bergen, Natural History Collectionslocation not on record	6
CASlocation not on record	6
PNHSlocation not on record	6
Gothenburg, SE	5
Los Angeles, US	4
Citadel Hill, GB	2
Paris, FR	2
RWSlocation not on record	2
Goteborg Natural History Museumlocation not on record	2
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
CEFASlocation not on record	1

14 institutions · 103 of 1 176 vouchered records shown

09Environmental DNA37 detections

Where the DNA of Diaphorodoris luteocincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map4 countries0

AlgaeHard substrateRock with algae (red algae and kelp)Rock with red algaeRock with algaenot_collected

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 3.50–15.0

Seasonal swing summer↔winter12.5 °C

Max temp (day)16.7 °C 4.60–18.9

Min temp (night)10.4 °C 2.60–12.4

Precipitation82.7 mm/mo 59.9–165

Air humidity62.7 % 58.3–65.5

Moisture balance7.40 mm/mo

Vapour deficit601 Pa 318–782

Wind speed3.20 m/s

Cloud cover51.3 % 40.9–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diaphorodoris luteocincta

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type3 283 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 283 records