Diaphorodoris lirulatocauda

Millen, 1985 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Calycidorididae/Diaphorodoris

At a glance

Occurrence records894

Data sources8

Biological traits4

DNA specimens4

eDNA detections5

Sources8 archives

Databases and archives Diaphorodoris lirulatocauda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility864 records↗

OBISOcean Biodiversity Information System30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS894 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD4 specimens

01Narrative

Diaphorodoris lirulatocauda is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Calycidorididae.Rosenberg, G. (2015). Diaphorodoris lirulatocauda Millen, 1985. In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2016-01-21.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length1.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diaphorodoris lirulatocauda has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

4Avariable

205Tmostly conserved

206Cvariable

253Amostly conserved

284Cmostly conserved

304Amostly conserved

313Amostly conserved

415Amostly conserved

478Cmostly conserved

523Tmostly conserved

544Avariable

TACATTATATATAATTTTTGGTATATGATGTGGTTTATTAGGGACTGGTTTAAGTTTATTAATTCGATTTGAATTAGGAACTGCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes3

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calycidoris guentherisame family13.4%Diaphorodoris luteocinctasame genus15.2%Sagaminopteron nigropunctatumsame order15.3%Peltodoris nobilissame order15.6%Phyllidiella nigrasame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type894 records

Wild obs. + sensor840

Museum / vouchered53

Other1

Range

Area of Occupancy AOO1 268 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 46 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 310≤1 km 141≤10 km 27>10 km 243

721 georeferenced · 119 without coordinates

Open the mapobservation + sensor840

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤1 km 18≤10 km 8

26 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Victoria, CA	5

3 institutions · 29 of 53 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Diaphorodoris lirulatocauda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

soft sediment, shell hashrock outcrop

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 10.9–14.4

Seasonal swing summer↔winter11.6 °C

Max temp (day)16.6 °C 14.7–18.5

Min temp (night)9.30 °C 7.20–11.4

Precipitation141 mm/mo 133–150

Air humidity63.8 % 62.6–65.0

Moisture balance31.6 mm/mo 22.2–40.9

Vapour deficit533 Pa 489–577

Wind speed4.40 m/s 4.20–4.60

Cloud cover37.3 % 36.5–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)