Corymica pryeri

(Butler, 1878) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Corymica

At a glance

Occurrence records681

Data sources8

Biological traits0

DNA specimens16

eDNA detections13

Sources8 archives

Databases and archives Corymica pryeri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility681 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF681 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD16 specimens

01Narrative

Corymica pryeri is a species of moth of the family Geometridae first described by Arthur Gardiner Butler in 1878. It is found in Japan, Taiwan, the north-eastern Himalayas, Sumatra, Borneo, New Guinea and possibly Queensland, Australia. The wingspan is 25–30 mm."ウコンエダシャク Corymica pryeri (Butler, 1878)". Japanese Moths. The larvae feed on Lindera, Neolitsea, Machilus, Meratia and Persea species. The larvae are slender and bright green with a blackish central stripe and blackish markings. Pupation takes place in foliage in a loose, rusty orange cocoon of silk.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymica pryeri has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes1

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

22Amostly conserved

70Cvariable

76Avariable

82Tmostly conserved

100Tvariable

103Tmostly conserved

121Cvariable

130Cvariable

136Tvariable

157Cvariable

175Amostly conserved

214Amostly conserved

235Cvariable

259Tmostly conserved

271Tmostly conserved

283Tmostly conserved

292Tmostly conserved

295Avariable

304Tvariable

325Avariable

337Cvariable

340Tvariable

346Cvariable

355Tmostly conserved

361Tmostly conserved

364Tmostly conserved

367Tmostly conserved

379Avariable

386Cvariable

397Cvariable

400Tvariable

401Tvariable

445Cmostly conserved

469Tmostly conserved

484Tmostly conserved

508Avariable

514Tmostly conserved

539Tmostly conserved

562Amostly conserved

578Cvariable

580Avariable

586Cmostly conserved

607Tvariable

613Cvariable

616Cvariable

619Avariable

622Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACATCTTTAAGATTATTAATTCGTGCCGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes4

BINs3

Most divergent pair5.5%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplochlora vivilacasame family7.1%Petelia medardariasame family7.4%Agonopterix atomellasame order7.9%Corymica arneariasame genus8.1%Agonopterix scopariellasame order8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type681 records

Wild obs. + sensor510

Museum / vouchered171

Range

Area of Occupancy AOO1 700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 39≤1 km 40≤10 km 9>10 km 16

104 georeferenced · 406 without coordinates

Open the mapobservation + sensor510

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	83
FACTlocation not on record	15
Sagamihara, JP	14
Taiwan Forestry Research Institutelocation not on record	13
Chiba, JP	11
Kawasaki Shi Tama Ku, JP	8
HUNMlocation not on record	6
Toyota city nature sanctuarylocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	2
NSMKlocation not on record	2
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	2
Hiwa Museum of Natural Historylocation not on record	2
National Institute for Agro-Environmental Scienceslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
ZSMlocation not on record	1
National Institute of Biological Resourceslocation not on record	1

16 institutions · 166 of 171 vouchered records shown · 5 without an institution code

09Environmental DNA13 detections

Where the DNA of Corymica pryeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 18.0–24.1

Seasonal swing summer↔winter6.10 °C

Max temp (day)25.1 °C 21.3–26.2

Min temp (night)19.8 °C 14.2–23.1

Precipitation174 mm/mo 48.3–342

Air humidity68.4 % 61.6–71.9

Moisture balance132 mm/mo

Vapour deficit815 Pa 594–1,140

Wind speed2.40 m/s

Cloud cover46.0 % 35.6–55.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)