Agonopterix scopariella

Heinemann, 1870 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records991

Data sources6

Biological traits2

DNA specimens89

eDNA detections0

Sources6 archives

Databases and archives Agonopterix scopariella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility991 records↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF991 records

DNA & barcodingBOLD89 specimens

01Narrative

Agonopterix scopariella is a moth of the family Depressariidae. It is found in most of Europe, except Ireland, most of the Balkan Peninsula, Ukraine, Finland and the Baltic region. The wingspan is 18–23 mm.microlepidoptera.nl Adults are variable, but usually have two black and two white spots on the wing. The white spots are often ringed by black scales. They are on wing from August to April. The larvae feed on broom (Cytisus scoparius). They feed in spun shoots of their host plant. Larvae can be found from June to late July.UKmoths The species overwinters as an adult.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix scopariella has left across the world's sequence archives.

At a glance

DNA specimens89

BINs1

Marker genes1

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus84 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

76Avariable

82Tmostly conserved

85Avariable

163Tvariable

235Tvariable

478Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes13

BIN1

Most divergent pair2.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix atomellasame genus1.8%Agonopterix omelkoisame genus2.3%Agonopterix argillaceasame genus2.3%Agonopterix straminellasame genus2.4%Agonopterix carduncellisame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type991 records

Wild obs. + sensor790

Museum / vouchered200

Other1

Origin

Native1

Range

Area of Occupancy AOO1 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 288≤1 km 222≤10 km 200>10 km 3

713 georeferenced · 77 without coordinates

Open the mapobservation + sensor790

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 97≤1 km 14≤10 km 54

165 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	125
NHMOlocation not on record	28
SLU Artdatabankenlocation not on record	9
University of Kaiserslauternlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Tilburg, NL	2
Edmonton, CA	2
neflocation not on record	2
New Haven, US	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Research Collection of Richard Heindellocation not on record	1
Tartu, EE	1
CIBIOlocation not on record	1
Nijmegen, NL	1
ZSMlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

16 institutions · 183 of 200 vouchered records shown · 17 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)