Aplochlora vivilaca

Walker, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aplochlora

At a glance

Occurrence records74

Data sources7

Biological traits0

DNA specimens12

eDNA detections4

Sources7 archives

Databases and archives Aplochlora vivilaca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD12 specimens

01Narrative

Aplochlora vivilaca is a moth of the family Geometridae first described by Francis Walker in 1861. It is found in Sri Lanka, Indian subregion, Taiwan, Borneo and Sulawesi. The male has bipectinate (comb-like on both sides) antennae. Its wings are greenish, which can lead to confusion with some members of Geometrinae. There is a black spot found closer to each cell in each wing. On the caterpillar the cylindrical and ground color ranges from greenish to apple green with oily surfaces. Segmental margins are yellow. Thoracic segments are purplish. Host plants of the caterpillar are Casearia and Holoptelea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplochlora vivilaca has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)6.6%

Haplotypes2

BINs2

Most divergent pair9.3%

Where individuals differ — all 88 variable positions, in barcode order

4Amostly conserved

46Amostly conserved

50Tmostly conserved

52Amostly conserved

55Amostly conserved

59Tvariable

70Tvariable

73Gvariable

88Tvariable

91Tmostly conserved

97Tmostly conserved

127Avariable

133Tmostly conserved

139Tmostly conserved

157Tmostly conserved

163Tmostly conserved

169Tvariable

172Tmostly conserved

181Avariable

184Amostly conserved

190Amostly conserved

193Tmostly conserved

202Tvariable

205Cvariable

206Tmostly conserved

212Tvariable

217Amostly conserved

218Gmostly conserved

223Avariable

238Amostly conserved

241Amostly conserved

259Tmostly conserved

263Tmostly conserved

265Amostly conserved

271Tvariable

274Tvariable

277Tmostly conserved

278Amostly conserved

280Tmostly conserved

284Tmostly conserved

286Amostly conserved

287Tmostly conserved

292Cvariable

295Avariable

316Amostly conserved

319Amostly conserved

322Tvariable

325Amostly conserved

334Avariable

337Tmostly conserved

340Tvariable

343Cvariable

346Tmostly conserved

352Tmostly conserved

358Cvariable

364Tmostly conserved

373Gvariable

376Amostly conserved

379Amostly conserved

385Tvariable

391Cmostly conserved

400Tmostly conserved

401Tmostly conserved

403Amostly conserved

406Tmostly conserved

415Tmostly conserved

433Gmostly conserved

436Amostly conserved

448Tmostly conserved

451Tmostly conserved

479Amostly conserved

484Tmostly conserved

514Tmostly conserved

517Amostly conserved

526Amostly conserved

562Amostly conserved

565Gmostly conserved

574Tmostly conserved

578Cmostly conserved

589Tmostly conserved

604Tmostly conserved

607Tmostly conserved

616Tmostly conserved

619Amostly conserved

625Amostly conserved

634Tvariable

637Avariable

641Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAGTTAGGTAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oxydia sociatasame family5.6%Aplochlora pisochroasame genus6.1%Melanolophia bostarsame family6.2%Aplochlora pseudossasame genus6.4%Gyostega floccosasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor40

Museum / vouchered34

Origin

Native2

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 9≤1 km 7≤10 km 3>10 km 3

22 georeferenced · 18 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
tesrilocation not on record	27
ZSM Collection of Manfred Sommererlocation not on record	4
SUVlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1

4 institutions · 34 of 34 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aplochlora vivilaca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 22.4–27.2

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.6 °C 26.3–29.6

Min temp (night)21.5 °C 18.3–24.3

Precipitation201 mm/mo 65.8–259

Air humidity66.3 % 64.0–68.9

Moisture balance70.1 mm/mo -100–130

Vapour deficit1,102 Pa 848–1,295

Wind speed1.30 m/s 1.20–2.10

Cloud cover35.6 % 18.8–55.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)