Chrysodeixis argentifera

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Chrysodeixis

At a glance

Occurrence records2 592

Data sources7

Biological traits0

DNA specimens118

eDNA detections113

Sources7 archives

Databases and archives Chrysodeixis argentifera's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 592 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI113 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics118 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 592 records

Environmental DNA1 datasets · 1 countries113 detections

DNA & barcodingBOLD118 specimens

01Narrative

The Tobacco looper (Chrysodeixis argentifera) is a moth of the family Noctuidae. It is found in Australia and New Zealand. The wingspan is ca. 30 mm. The larvae feed on various plants, including Sunflower, Canola, Tomato, various Beans and Silver Beet.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding118 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysodeixis argentifera has left across the world's sequence archives.

At a glance

DNA specimens118

BINs1

Marker genes2

eDNA detections113

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus109 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes16

BIN1

Most divergent pair0.76%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysodeixis illuminatasame genus4.7%Chrysodeixis dinawasame genus5.0%Chrysodeixis includenssame genus5.2%Chrysodeixis acutasame genus5.3%Thysanoplusia intermixtasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 592 records

Wild obs. + sensor1 929

Museum / vouchered278

Other385

Origin

Native3

Range

Area of Occupancy AOO3 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 832≤1 km 355≤10 km 146>10 km 137

1 470 georeferenced · 459 without coordinates

Open the mapobservation + sensor1 929

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 13≤10 km 3

16 georeferenced · 262 without coordinates

Open the institutions mapphysical evidence278

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	107
Museums Victorialocation not on record	99
Natick, US	7
Sydney, AU	4
ZSMlocation not on record	3
Australian National Insect Collectionlocation not on record	2
Research Collection of Egbert Friedrichlocation not on record	2
QVMAGlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1
Tallinn, EE	1
Helsinki, FI	1

12 institutions · 229 of 278 vouchered records shown · 49 without an institution code

09Environmental DNA113 detections

Where the DNA of Chrysodeixis argentifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found113

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 113 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 12.2–22.7

Seasonal swing summer↔winter13.5 °C

Max temp (day)23.8 °C 17.4–29.1

Min temp (night)14.1 °C 6.90–20.9

Precipitation63.5 mm/mo 21.8–142

Air humidity57.0 % 47.1–62.6

Moisture balance-56.1 mm/mo -159–50.5

Vapour deficit908 Pa 622–1,457

Wind speed2.90 m/s 2.40–4.60

Cloud cover20.4 % 13.3–30.2

CHELSA 1981–2010, ~9 km grid, at location & month of 112 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysodeixis argentifera

At a glance

Sources7 archives

At a glance

Record type2 592 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 592 records