Chrysodeixis includens

Walker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Chrysodeixis

At a glance

Occurrence records4 251

Data sources9

Biological traits0

DNA specimens388

eDNA detections386

Sources9 archives

Databases and archives Chrysodeixis includens's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI386 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics388 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 251 records

Environmental DNA1 datasets · 14 countries386 detections

DNA & barcodingBOLD388 specimens

Genome at a glanceGoaT · NCBI≈380 Mbp

01Narrative

Chrysodeixis includens, the soybean looper, is a moth of the family Noctuidae. It is known as falso medidor in north-eastern Mexico. It is found from southern Quebec and southern Ontario through the eastern and southern part of the United States to Central America and South America, the Antilles and the Galápagos Islands. It is known to be migratory. The species was first described by Francis Walker in 1858. Caterpillar The wingspan is 28–39 mm. The adults are on wing from April to November depending on the location. The larvae feed on a wide range of plants. Recorded food plants are Asteraceae, Brassicaceae, Commelinaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Lamiaceae, Lauraceae, Malvaceae, Solanaceae, Verbenaceae, Medicago sativa, Phaseolus polystachios, Glycine max, Gossypium herbaceum, Nicotiana tabacum, Lycopersicum esculentum, Brassica and Lactuca sativa. The Mexican free-tailed bat (Tadarida brasiliensis) may feed on the soybean looper.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding388 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysodeixis includens has left across the world's sequence archives.

At a glance

DNA specimens388

BINs1

Marker genes2

eDNA detections386

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus359 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCATTAAGATTACTAATTCGAGCAGAATTAGGTACCCCTGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes15

BIN1

Most divergent pair0.61%

N.AmericaOtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysodeixis illuminatasame genus4.1%Chrysodeixis dinawasame genus4.1%Chrysodeixis acutasame genus4.4%Chrysodeixis subsidenssame genus5.0%Plusiopalpa adrastasame family5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Chrysodeixis includens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈379 968 472 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Chrysodeixis includens0.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type4 251 records

Wild obs. + sensor3 623

Museum / vouchered628

Range

Area of Occupancy AOO8 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 856≤1 km 580≤10 km 189>10 km 373

2 998 georeferenced · 625 without coordinates

Open the mapobservation + sensor3 623

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 14≤1 km 87≤10 km 216>10 km 54

371 georeferenced · 257 without coordinates

Open the institutions mapphysical evidence628

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	95
Cambridge, US	87
East Lansing, US	83
Mississippi State, US	66
CUlocation not on record	65
San Diego, US	32
University of Alberta Museums (UAM)location not on record	30
St. Paul, US	15
Tapachula, MX	14
Colorado State Universitylocation not on record	14
The University of the West Indies, Trinidad and Tobagolocation not on record	9
Natural History Museum Rotterdamlocation not on record	8
Helsinki, FI	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
University of California, Davislocation not on record	5
SOVTlocation not on record	5
UNICAMPlocation not on record	4
University of Pennsylvanialocation not on record	2
Decorah, US	2
RMNHlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Toronto, CA	2
Champaign, US	2
Natural History Museum of Utahlocation not on record	1
Philadelphia, US	1
Albuquerque, US	1
Paris, FR	1
UMUlocation not on record	1

29 institutions · 565 of 628 vouchered records shown · 63 without an institution code

09Environmental DNA386 detections

Where the DNA of Chrysodeixis includens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found386

Studies independent surveys1

Countries14

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 386 detections have coordinates

Open the map14 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 17.6–25.6

Seasonal swing summer↔winter2.50 °C

Max temp (day)26.9 °C 21.9–29.1

Min temp (night)21.1 °C 15.5–23.7

Precipitation113 mm/mo 39.5–358

Air humidity68.1 % 60.9–72.2

Moisture balance33.0 mm/mo -107–301

Vapour deficit910 Pa 697–1,182

Wind speed2.60 m/s 0.9–5.70

Cloud cover39.0 % 15.1–59.9

CHELSA 1981–2010, ~9 km grid, at location & month of 230 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysodeixis includens

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 251 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 251 records