Chrysodeixis acuta

(Walker) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Chrysodeixis

At a glance

Occurrence records374

Data sources7

Biological traits2

DNA specimens98

eDNA detections108

Sources7 archives

Databases and archives Chrysodeixis acuta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility374 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI108 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF374 records

Environmental DNA1 datasets · 19 countries108 detections

DNA & barcodingBOLD98 specimens

01Narrative

Chrysodeixis acuta, the tunbridge wells gem, is a moth of the family Noctuidae. It is found in Africa as well as the on Canary Islands eastwards to Australasia Indonesia and Oceania. The wingspan is 35–45 mm. The larvae feed on various plants, including barley, linseed and sorghum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysodeixis acuta has left across the world's sequence archives.

At a glance

DNA specimens98

BINs1

Marker genes1

eDNA detections108

Countries20

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus93 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCCTTAAGATTATTAATTCGAGCAGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes8

BIN1

Most divergent pair2.0%

AfricaOceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysodeixis illuminatasame genus2.9%Chrysodeixis dinawasame genus2.9%Chrysodeixis includenssame genus4.4%Chrysodeixis argentiferasame genus5.3%Thysanoplusia orichalceasame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_066154 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type374 records

Wild obs. + sensor199

Museum / vouchered171

Other4

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 51≤1 km 20≤10 km 31>10 km 4

106 georeferenced · 93 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 4≤1 km 2≤10 km 9

15 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	49
ZSMlocation not on record	22
Durban Natural Science Museumlocation not on record	17
tesrilocation not on record	9
National Museums of Kenyalocation not on record	9
Natural History Museum Rotterdamlocation not on record	8
Taiwan Forestry Research Institutelocation not on record	5
UMUlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	3
Sydney, AU	3
Tartu, EE	2
DanishLepidopterologicalSocietylocation not on record	1
Research Collection of Graeme V. Cockslocation not on record	1
DPIlocation not on record	1
Australian National Fish Collectionlocation not on record	1
Hiwa Museum of Natural Historylocation not on record	1
FACTlocation not on record	1

17 institutions · 137 of 171 vouchered records shown · 34 without an institution code

09Environmental DNA108 detections

Where the DNA of Chrysodeixis acuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found108

Studies independent surveys1

Countries19

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 108 detections have coordinates

Open the map19 countries0

2. Savanna4. Native Grassland | 4.6. Subtropical/Tropi…Knob Thorn/MarulaÂ Savannah2. Savanna | 2.1. Dry Savanna14. Artificial - Terrestrial|14.5 Urban AreasForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 18.5–27.7

Seasonal swing summer↔winter7.30 °C

Max temp (day)27.4 °C 23.4–32.2

Min temp (night)19.2 °C 13.4–23.9

Precipitation118 mm/mo 36.1–314

Air humidity61.1 % 55.1–69.6

Moisture balance-29.8 mm/mo -87.1–194

Vapour deficit1,090 Pa 781–1,516

Wind speed2.60 m/s 1.30–3.90

Cloud cover31.5 % 19.5–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 98 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)