Chrysochus auratus

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Chrysochus

At a glance

Occurrence records13 227

Data sources9

Biological traits0

DNA specimens24

eDNA detections23

Sources9 archives

Databases and archives Chrysochus auratus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

GBIFGlobal Biodiversity Information Facility13 227 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF13 227 records

Environmental DNA1 datasets · 3 countries23 detections

DNA & barcodingBOLD24 specimens

Genome at a glanceGoaT · TreeOfSex2n = 26

01Narrative

dog bane beetle (Chrysochus auratus) Chrysochus auratus, the dogbane beetle, of eastern North America, is a member of the leaf beetle subfamily Eumolpinae. It is primarily found east of the Rocky Mountains. Its diet mainly consists of dogbane (Apocynum), specifically Apocynum cannabinum and Apocynum androsaemifolium, and occasionally it eats milkweed. It is 8-11 mm long and has a convex, oval shape.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysochus auratus has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes3

eDNA detections23

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Diversity (π)2.5%

Haplotypes2

BINs2

Most divergent pair0.61%

Where individuals differ — all 125 variable positions, in barcode order

18Gmostly conserved

20Tmostly conserved

21Tmostly conserved

22Tmostly conserved

23Amostly conserved

29Tmostly conserved

36Cmostly conserved

38Tmostly conserved

44Tmostly conserved

47Amostly conserved

53Amostly conserved

54Amostly conserved

57Amostly conserved

59Tmostly conserved

62Tmostly conserved

65Tmostly conserved

72Cmostly conserved

74Tmostly conserved

79Gmostly conserved

83Tmostly conserved

89Amostly conserved

92Tmostly conserved

98Amostly conserved

101Tmostly conserved

104Cmostly conserved

110Tmostly conserved

116Tmostly conserved

117Tmostly conserved

119Tmostly conserved

120Avariable

131Cmostly conserved

134Tmostly conserved

143Cmostly conserved

152Cmostly conserved

168Avariable

200Amostly conserved

209Gmostly conserved

215Amostly conserved

218Cmostly conserved

221Tmostly conserved

233Cmostly conserved

242Amostly conserved

248Cmostly conserved

260Amostly conserved

261Cmostly conserved

263Tmostly conserved

272Gmostly conserved

280Gmostly conserved

281Tmostly conserved

288Gmostly conserved

290Tmostly conserved

310Gmostly conserved

311Amostly conserved

314Tmostly conserved

317Tmostly conserved

320Tmostly conserved

323Cmostly conserved

332Amostly conserved

341Tmostly conserved

344Amostly conserved

345Tmostly conserved

350Tmostly conserved

351Tmostly conserved

353Amostly conserved

357Gmostly conserved

359Amostly conserved

360Amostly conserved

362Tmostly conserved

371Tmostly conserved

374Amostly conserved

375Tmostly conserved

376Cmostly conserved

384Cmostly conserved

392Tmostly conserved

405Cmostly conserved

410Tmostly conserved

413Gvariable

414Amostly conserved

416Tmostly conserved

422Amostly conserved

425Cmostly conserved

446Tmostly conserved

449Tmostly conserved

455Amostly conserved

470Cmostly conserved

471Cmostly conserved

472Amostly conserved

476Gvariable

480Tmostly conserved

482Amostly conserved

483Amostly conserved

485Amostly conserved

488Cmostly conserved

493Tmostly conserved

494Tmostly conserved

497Amostly conserved

503Cmostly conserved

512Tmostly conserved

516Cmostly conserved

521Cmostly conserved

524Amostly conserved

527Amostly conserved

530Tmostly conserved

531Tmostly conserved

533Amostly conserved

536Tmostly conserved

537Tmostly conserved

539Gmostly conserved

540Tmostly conserved

542Gmostly conserved

551Tmostly conserved

554Cmostly conserved

557Gmostly conserved

566Cmostly conserved

569Tmostly conserved

579Tmostly conserved

581Gmostly conserved

590Tmostly conserved

594Cmostly conserved

596Tmostly conserved

+5 more variable positions not shown

CTTTATATTTTATTTTTGGTTTATGATCTGGAATACTTGGAACTTCACTAAGAATAATTATTCGTATTGAACTTGGAAGTCCTGGAACAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysochus asclepiadeussame genus16.4%Trichodes apiariussame order17.0%Charidotella sexpunctatasame family17.0%Neocrepidodera cyanipennissame family17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Chrysochus auratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome records26–262n range26median26mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 265×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type13 227 records

Wild obs. + sensor12 162

Museum / vouchered1 065

Range

Area of Occupancy AOO30 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 6 655≤1 km 1 823≤10 km 569>10 km 854

9 901 georeferenced · 2 261 without coordinates

Open the mapobservation + sensor12 162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 13≤1 km 89≤10 km 573>10 km 140

815 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence1 065

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	229
Lubbock, US	206
Denver, US	143
Universidad Católica de Manizaleslocation not on record	101
Natural History Museum of Utahlocation not on record	57
Royal Saskatchewan Museumlocation not on record	53
Chicago, US	45
University Park, US	29
Espace pour la vielocation not on record	24
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	22
University of Alberta Museums (UAM)location not on record	20
College Station, US	15
Wuzhou, CN	14
Saint John, CA	13
University of Guelphlocation not on record	12
US	10
OSUClocation not on record	8
University of Central Floridalocation not on record	7
WIlocation not on record	6
Champaign, US	6
Colorado State Universitylocation not on record	6
SOVTlocation not on record	5
Cambridge, US	5
Provo, US	5
UDlocation not on record	5
Cornell University Insect Collectionlocation not on record	5
Philadelphia, US	4
Decorah, US	3
Albuquerque, US	1
Washington, US	1
Museo del Instituto de Zoologia Agricola Francisco Fernandez Yepezlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
CUlocation not on record	1

33 institutions · 1 063 of 1 065 vouchered records shown · 1 without an institution code

09Environmental DNA23 detections

Where the DNA of Chrysochus auratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map3 countries0

Temperate mixed forestTallgrass savannah14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 14.4–21.6

Seasonal swing summer↔winter25.6 °C

Max temp (day)25.8 °C 19.8–25.8

Min temp (night)17.2 °C 10.2–17.2

Precipitation103 mm/mo 90.4–175

Air humidity60.2 % 57.5–60.6

Moisture balance-59.1 mm/mo -65.2–46.0

Vapour deficit1,025 Pa 757–1,025

Wind speed4.30 m/s 2.60–5.00

Cloud cover41.8 % 37.0–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysochus auratus

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type13 227 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 227 records