Charidotella sexpunctata

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Charidotella

At a glance

Occurrence records5 078

Data sources9

Biological traits0

DNA specimens30

eDNA detections20

Sources9 archives

Databases and archives Charidotella sexpunctata's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 078 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 078 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD30 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Larva Pupa Charidotella sexpunctata, the golden tortoise beetle, is a species of beetle in the leaf beetle family, Chrysomelidae. It is native to the Americas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Charidotella sexpunctata has left across the world's sequence archives.

At a glance

DNA specimens30

BINs5

Marker genes3

eDNA detections20

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.9%

Haplotypes2

BINs5

Most divergent pair3.4%

Where individuals differ — all 54 variable positions, in barcode order

1Amostly conserved

2Cmostly conserved

3Amostly conserved

18Tmostly conserved

21Tvariable

22Tmostly conserved

39Tmostly conserved

58Tvariable

78Tmostly conserved

90Cvariable

93Amostly conserved

102Cmostly conserved

111Tvariable

135Tmostly conserved

186Cvariable

192Tmostly conserved

225Cmostly conserved

228Avariable

234Tvariable

240Tvariable

249Cmostly conserved

258Tvariable

261Amostly conserved

265Tmostly conserved

267Amostly conserved

270Cvariable

285Tmostly conserved

289Cvariable

303Amostly conserved

304Gmostly conserved

318Tvariable

324Tmostly conserved

333Amostly conserved

351Cmostly conserved

357Tmostly conserved

378Amostly conserved

399Gmostly conserved

405Tvariable

426Cmostly conserved

453Tmostly conserved

471Tmostly conserved

507Tvariable

519Tmostly conserved

546Amostly conserved

547Tvariable

549Amostly conserved

555Tvariable

561Cmostly conserved

573Tmostly conserved

577Tmostly conserved

580Tvariable

600Tmostly conserved

633Cvariable

645Tvariable

ACATTATATTTTATTTTTGGTTTATGATCAGGAATAATTGGAACTGCTTTAAGAATTTTAATTCGAGCTGAACTAGGTAATCCTGGAACC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Charidotella purpuratasame genus9.3%Jonthonota nigripessame family12.1%Aleochara latasame order16.4%Heterostegane serratasame order16.4%Elachista sagarasame order16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Charidotella sexpunctata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–242n range22median22mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 229×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

TreeOfSex · invert — Virkki N, Santiagoblay JA, Riley EG (1992) Chromosomes of Puerto-Rican Hispinae and Cassidinae (Coleoptera, Chrysomelidae). Coleopterists Bulletin 46: 29-42. ↗

2n 241×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type5 078 records

Wild obs. + sensor4 206

Museum / vouchered872

Range

Area of Occupancy AOO12 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 2 105≤1 km 692≤10 km 296>10 km 427

3 520 georeferenced · 686 without coordinates

Open the mapobservation + sensor4 206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 29≤1 km 14≤10 km 71>10 km 55

169 georeferenced · 703 without coordinates

Open the institutions mapphysical evidence872

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	519
Lexington, US	106
Museo Entomologico de Leonlocation not on record	61
Ciudad de México, MX	39
Santa Barbara Museum of Natural Historylocation not on record	24
Facultad de Ingeniería y Ciencias, Universidad Autónoma de Tamaulipaslocation not on record	18
College Station, US	17
Denver, US	13
US	13
Philadelphia, US	12
Cambridge, US	11
Tapachula, MX	6
Wuzhou, CN	6
The University of the West Indies, Trinidad and Tobagolocation not on record	5
US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Espace pour la vielocation not on record	1
Chicago, US	1
MX	1
Albuquerque, US	1
ZSMlocation not on record	1
SOVTlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
CUlocation not on record	1

24 institutions · 864 of 872 vouchered records shown · 7 without an institution code

09Environmental DNA20 detections

Where the DNA of Charidotella sexpunctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

14. Artificial - Terrestrial|14.1 Arable Land

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 12.9–24.0

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.7 °C 18.6–27.2

Min temp (night)13.4 °C 7.90–20.0

Precipitation93.5 mm/mo 80.9–392

Air humidity57.6 % 55.2–67.2

Moisture balance-35.6 mm/mo -61.2–264

Vapour deficit823 Pa 633–1,035

Wind speed3.50 m/s 1.30–4.10

Cloud cover41.5 % 33.3–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Charidotella sexpunctata

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 078 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 078 records