Jonthonota nigripes

(Olivier, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Jonthonota

At a glance

Occurrence records226

Data sources7

Biological traits0

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Jonthonota nigripes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Jonthonota nigripes, the blacklegged tortoise beetle, is a species of tortoise beetle in the family Chrysomelidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Jonthonota nigripes has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes2

BIN1

Most divergent pair1.8%

Where individuals differ — all 20 variable positions, in barcode order

79Gvariable

265Gvariable

271Avariable

283Cmostly conserved

316Tmostly conserved

319Avariable

328Gvariable

334Cvariable

347Tvariable

451Amostly conserved

454Cvariable

475Amostly conserved

526Amostly conserved

535Tmostly conserved

557Tmostly conserved

558Tmostly conserved

610Tmostly conserved

613Tvariable

628Gmostly conserved

631Amostly conserved

AACATTATACTTCATTTTTGGTTTTTGGGCAGGAATAATTGGAACTGCTTTAAGGATTCTTATTCGAGCTGAATTGGGGAATCCTGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Charidotella purpuratasame family12.0%Charidotella sexpunctatasame family12.1%Bledius furcatussame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor114

Museum / vouchered112

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 59≤1 km 19≤10 km 7>10 km 11

96 georeferenced · 18 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 7≤1 km 3≤10 km 33>10 km 7

50 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	47
Essig Museum of Entomologylocation not on record	15
Denver, US	9
Washington, US	8
US	7
Universidad Católica de Manizaleslocation not on record	5
College Station, US	4
Lexington, US	3
Albuquerque, US	2
Lubbock, US	2
Wuzhou, CN	2
Cambridge, US	2
San Luis Potosí, MX	1
Museo Entomologico de Leonlocation not on record	1
CUlocation not on record	1
Budapest, HU	1
Natural History Museum of Utahlocation not on record	1
Colorado State Universitylocation not on record	1

18 institutions · 112 of 112 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Jonthonota nigripes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.50 °C 1.10–16.1

Seasonal swing summer↔winter24.7 °C

Max temp (day)10.6 °C 6.00–23.4

Min temp (night)1.10 °C -3.10–10.9

Precipitation89.5 mm/mo 71.5–107

Air humidity57.9 % 53.4–59.3

Moisture balance27.1 mm/mo -81.5–37.7

Vapour deficit383 Pa 278–907

Wind speed6.30 m/s 5.80–6.30

Cloud cover35.4 % 34.7–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)