Chrysochus asclepiadeus

(Pallas, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Chrysochus

At a glance

Occurrence records712

Data sources9

Biological traits0

DNA specimens4

eDNA detections1

Sources9 archives

Databases and archives Chrysochus asclepiadeus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility712 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF712 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Chrysochus asclepiadeus (or Eumolpus asclepiadeus) is a member of the leaf beetle subfamily Eumolpinae. It is considered the type species of the genus Chrysochus, though it has sometimes been placed within the genus Eumolpus. It is the only species of Chrysochus distributed in the western Palaearctic. It is mainly found in Europe, though it is also known from Kazakhstan and Turkey in Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysochus asclepiadeus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes2

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes1

BIN1

Where individuals differ — all 17 variable positions, in barcode order

58Cvariable

82Cvariable

136Tvariable

206Tvariable

295Avariable

400Avariable

502Cvariable

542Tvariable

550Gvariable

578Tvariable

581Tvariable

619Cvariable

620Avariable

621Avariable

622Avariable

625Avariable

626Avariable

AACTTTATATTTTATTTTTGGAGCATGAGCAGGAATACTAGGAACCTCCCTGAGATTCCTTATTCGTATCGAATTAGGAAACCCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysochus chinensissame genus12.9%Chrysochus auratussame genus16.4%Yukoana carinicollissame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Chrysochus asclepiadeus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type712 records

Wild obs. + sensor653

Museum / vouchered39

Other20

Range

Area of Occupancy AOO1 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 217≤1 km 79≤10 km 43>10 km 13

352 georeferenced · 301 without coordinates

Open the mapobservation + sensor653

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤1 km 20≤10 km 11>10 km 1

32 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Provincia di Livornolocation not on record	16
Natural History Museum Rotterdamlocation not on record	8
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	5
Museu Nacional de História Natural e da Ciêncialocation not on record	1
NMOKlocation not on record	1
NTNU-VMlocation not on record	1

6 institutions · 32 of 39 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Chrysochus asclepiadeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)