Bradina atopalis

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Bradina

At a glance

Occurrence records173

Data sources7

Biological traits0

DNA specimens194

eDNA detections194

Sources7 archives

Databases and archives Bradina atopalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI194 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics194 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 2 countries194 detections

DNA & barcodingBOLD194 specimens

01Narrative

Bradina atopalis is a moth of the family Crambidae described by Francis Walker in 1858. It is found in China, Taiwan, Japan, Korea and Russia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding194 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bradina atopalis has left across the world's sequence archives.

At a glance

DNA specimens194

BINs1

Marker genes1

eDNA detections194

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus194 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

1Tmostly conserved

2Tmostly conserved

3Gmostly conserved

5Gmostly conserved

6Gmostly conserved

8Amostly conserved

9Gmostly conserved

10Tmostly conserved

12Gmostly conserved

175Cvariable

186Gmostly conserved

204Cmostly conserved

603Tmostly conserved

628Gmostly conserved

629Amostly conserved

TTGAGGGAGTGGACTTCTTTAAGATTATTAATCCGAGCTGAATTAGGAAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes32

BIN1

Most divergent pair3.5%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bradina geminalissame genus5.3%Bradina impressalissame genus6.4%Bradina admixtalissame genus6.4%Bradina erilitoidessame genus6.4%Bradina diagonalissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor163

Museum / vouchered10

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2≤10 km 1

4 georeferenced · 159 without coordinates

Open the mapobservation + sensor163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toyota city nature sanctuarylocation not on record	6
Iwate Prefectural Museumlocation not on record	2
Kawasaki Shi Tama Ku, JP	1

3 institutions · 9 of 10 vouchered records shown · 1 without an institution code

09Environmental DNA194 detections

Where the DNA of Bradina atopalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found194

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 194 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 18.0–24.6

Seasonal swing summer↔winter26.0 °C

Max temp (day)27.0 °C 22.1–28.2

Min temp (night)19.4 °C 13.4–20.1

Precipitation153 mm/mo 153–192

Air humidity64.3 % 60.2–64.3

Moisture balance9.70 mm/mo 9.70–70.1

Vapour deficit1,025 Pa 844–1,186

Wind speed3.20 m/s 1.60–3.20

Cloud cover35.4 % 31.5–35.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)