Bradina geminalis

Caradja, 1927 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Bradina

At a glance

Occurrence records1 173

Data sources7

Biological traits0

DNA specimens25

eDNA detections27

Sources7 archives

Databases and archives Bradina geminalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 173 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD25 specimens

01Narrative

Bradina geminalis is a moth in the family Crambidae. It was described by Aristide Caradja in 1927. It is found in China and Japan.Japanese Moths

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bradina geminalis has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

79Avariable

181Amostly conserved

271Gmostly conserved

292Tmostly conserved

343Cmostly conserved

472Tmostly conserved

520Tmostly conserved

610Cvariable

631Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes7

BIN1

Most divergent pair1.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bradina impressalissame genus4.0%Bradina diagonalissame genus4.0%Bradina admixtalissame genus4.0%Bradina erilitoidessame genus4.1%Dracaenura horochroasame family4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 173 records

Wild obs. + sensor1 042

Museum / vouchered131

Range

Area of Occupancy AOO2 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 17≤1 km 3

20 georeferenced · 1 022 without coordinates

Open the mapobservation + sensor1 042

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	102
HUNMlocation not on record	21
Toyota city nature sanctuarylocation not on record	3
National Institute of Biological Resourceslocation not on record	1
KNAMlocation not on record	1
Chiba, JP	1
National Institute for Agro-Environmental Scienceslocation not on record	1
tesrilocation not on record	1

8 institutions · 131 of 131 vouchered records shown

09Environmental DNA27 detections

Where the DNA of Bradina geminalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 23.2–27.6

Seasonal swing summer↔winter23.0 °C

Max temp (day)27.5 °C 24.4–30.8

Min temp (night)22.1 °C 21.5–24.2

Precipitation257 mm/mo 241–341

Air humidity67.4 % 64.5–73.5

Moisture balance105 mm/mo 86.5–203

Vapour deficit1,018 Pa 755–1,310

Wind speed2.50 m/s 2.30–4.50

Cloud cover40.8 % 37.5–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bradina geminalis

At a glance

Sources7 archives

At a glance

Record type1 173 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 173 records