Bradina admixtalis

(Walker, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Bradina

At a glance

Occurrence records405

Data sources7

Biological traits0

DNA specimens46

eDNA detections55

Sources7 archives

Databases and archives Bradina admixtalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF405 records

Environmental DNA1 datasets · 13 countries55 detections

DNA & barcodingBOLD46 specimens

01Narrative

Bradina admixtalis is a species of moth of the family Crambidae described by Francis Walker in 1859. It is found in Australia (Victoria, New South Wales and Queensland), New Guinea, New Zealand, south-east Asia and the Comoros, Réunion, South Africa as well as India. The wingspan is about 20 mm. The wings are pale brown. The forewings have a dark costa with two dark marks. The larvae feed on grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bradina admixtalis has left across the world's sequence archives.

At a glance

DNA specimens46

BINs5

Marker genes1

eDNA detections55

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

22Gvariable

59Tvariable

82Tmostly conserved

88Tvariable

118Tmostly conserved

133Tvariable

178Tmostly conserved

193Cvariable

205Cvariable

212Cvariable

217Avariable

229Amostly conserved

235Cvariable

238Tmostly conserved

271Tvariable

274Tmostly conserved

287Tmostly conserved

313Tvariable

346Tvariable

355Tmostly conserved

367Tvariable

385Tmostly conserved

386Tmostly conserved

397Cvariable

400Tvariable

401Tvariable

403Avariable

407Tmostly conserved

412Tvariable

415Tvariable

421Tvariable

430Avariable

433Amostly conserved

475Tvariable

490Tvariable

518Gvariable

533Tvariable

547Cvariable

553Tmostly conserved

574Tvariable

581Cvariable

607Tvariable

622Tmostly conserved

634Tvariable

TACTTTATATTTTATTTTTGGGATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes7

BINs5

Most divergent pair4.6%

OceaniaAfricaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bradina diagonalissame genus2.9%Bradina impressalissame genus3.2%Bradina geminalissame genus4.0%Bradina erilitoidessame genus5.2%Bradina melanoperassame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type405 records

Wild obs. + sensor390

Museum / vouchered14

Other1

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 168≤1 km 101≤10 km 13>10 km 13

295 georeferenced · 95 without coordinates

Open the mapobservation + sensor390

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 2>10 km 3

6 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	5
Durban Natural Science Museumlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
Sydney, AU	1

4 institutions · 9 of 14 vouchered records shown · 5 without an institution code

09Environmental DNA55 detections

Where the DNA of Bradina admixtalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map13 countries0

1. Forest & Woodland1. Forest & Woodland | 1.6. Subtropical/Trop…Mopane/Bushwillow Woodlands2. Savanna | 2.1. Dry SavannaUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 19.1–26.8

Seasonal swing summer↔winter7.80 °C

Max temp (day)26.4 °C 20.9–29.0

Min temp (night)18.0 °C 14.5–24.4

Precipitation104 mm/mo 20.6–262

Air humidity65.7 % 55.0–70.0

Moisture balance-23.2 mm/mo -95.5–157

Vapour deficit1,027 Pa 678–1,193

Wind speed2.90 m/s 1.70–4.20

Cloud cover39.4 % 10.5–56.2

CHELSA 1981–2010, ~9 km grid, at location & month of 54 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)