Batrachedra praeangusta

(Haworth, 1828) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Batrachedridae/Batrachedra

At a glance

Occurrence records4 677

Data sources9

Biological traits2

DNA specimens76

eDNA detections148

Sources9 archives

Databases and archives Batrachedra praeangusta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 677 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI148 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics76 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 677 records

Environmental DNA3 datasets · 11 countries148 detections

DNA & barcodingBOLD76 specimens

Genome at a glanceGoaT · NCBI≈487 Mbp

01Narrative

Batrachedra praeangusta is a moth of the family Batrachedridae which is native to Europe. It is also found in North America. It was first described by Adrian Haworth in 1828 from the type specimen found in England. The foodplants of the larvae are poplars (Populus species) and willows (Salix species).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding76 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Batrachedra praeangusta has left across the world's sequence archives.

At a glance

DNA specimens76

BINs5

Marker genes2

eDNA detections148

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus64 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

1Avariable

13Tvariable

28Avariable

55Cvariable

79Gvariable

127Tvariable

133Tvariable

205Cvariable

295Tvariable

313Tvariable

337Tvariable

397Cmostly conserved

400Tvariable

415Avariable

451Avariable

523Cvariable

541Tvariable

553Cmostly conserved

628Avariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGCTTATTAATTCGAGCTGAATTAGGGAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes5

BINs5

Most divergent pair2.7%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Batrachedra striolatasame genus5.8%Batrachedra curvilineellasame genus8.4%Pterocyclophora ridleyisame order8.7%Idaea illustriorsame order8.8%Metaxmeste schrankianasame order9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Batrachedra praeangusta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈486 926 467 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Batrachedra praeangusta0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.9% BUSCO

08Occurrence & distribution

Record type4 677 records

Wild obs. + sensor3 815

Museum / vouchered843

Other19

Origin

Native7

Range

Area of Occupancy AOO7 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 1 738≤1 km 852≤10 km 1 058>10 km 8

3 656 georeferenced · 159 without coordinates

Open the mapobservation + sensor3 815

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 393≤1 km 130≤10 km 31

554 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence843

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	209
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	144
NHMOlocation not on record	75
SLU Artdatabankenlocation not on record	49
University of Alberta Museums (UAM)location not on record	35
Kuopio, FI	33
Tartu, EE	31
Stockholm, SE	21
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	20
Provincia di Livornolocation not on record	18
Nijmegen, NL	11
Natural History Museum Rotterdamlocation not on record	9
Washington, US	8
Rovaniemi, FI	7
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	6
ZMAAlocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Trondheim, NO	4
NTNU-VMlocation not on record	4
South Kensington, GB	3
ZSMlocation not on record	2
Salzburg, AT	2
Tilburg, NL	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
BioFokuslocation not on record	1
Metsähallituslocation not on record	1
neflocation not on record	1
Research Collection of Richard Heindellocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
San Francisco, US	1
Research Collection of Jeremy deWaardlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

34 institutions · 715 of 843 vouchered records shown · 128 without an institution code

09Environmental DNA148 detections

Where the DNA of Batrachedra praeangusta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found148

Studies independent surveys3

Countries11

Verifiable raw sequence linked72

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 148 detections have coordinates

Open the map11 countries0

Grassland4. Native GrasslandBoreal forest near riverForestAspen forest1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 13.2–18.0

Seasonal swing summer↔winter19.7 °C

Max temp (day)20.2 °C 17.0–22.8

Min temp (night)11.8 °C 8.80–13.9

Precipitation84.3 mm/mo 54.0–111

Air humidity60.0 % 56.6–63.5

Moisture balance-29.6 mm/mo -70.8–11.2

Vapour deficit726 Pa 606–882

Wind speed2.70 m/s 1.50–3.80

Cloud cover47.3 % 34.8–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 142 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Batrachedra praeangusta

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 677 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 677 records