Batrachedra striolata

Zeller, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Batrachedridae/Batrachedra

At a glance

Occurrence records40

Data sources7

Biological traits0

DNA specimens16

eDNA detections16

Sources7 archives

Databases and archives Batrachedra striolata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF40 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Batrachedra striolata is a moth in the family Batrachedridae. It is found in North America, where it has been recorded from British Columbia to California.mothphotographersgroup The larvae have been recorded feeding on Agave shawii, and Salix lasiolepis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Batrachedra striolata has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

13Tmostly conserved

19Tmostly conserved

79Gmostly conserved

88Amostly conserved

100Gmostly conserved

103Tmostly conserved

106Tmostly conserved

118Cmostly conserved

139Tmostly conserved

202Tmostly conserved

212Cmostly conserved

238Tmostly conserved

250Tmostly conserved

274Cmostly conserved

295Gmostly conserved

318Cmostly conserved

340Tmostly conserved

460Cmostly conserved

514Amostly conserved

562Amostly conserved

574Amostly conserved

616Tmostly conserved

622Gmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGGAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes6

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Batrachedra praeangustasame genus5.8%Batrachedra curvilineellasame genus7.3%Europlema nivosariasame order8.4%Idaea ossiculatasame order8.7%Epicopeia menciasame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type40 records

Museum / vouchered40

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 10≤1 km 3>10 km 2

15 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence40

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Essig Museum of Entomologylocation not on record	13
Cambridge, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 38 of 40 vouchered records shown · 2 without an institution code

09Environmental DNA16 detections

Where the DNA of Batrachedra striolata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 16.3–18.5

Seasonal swing summer↔winter8.40 °C

Max temp (day)22.3 °C 20.8–26.2

Min temp (night)13.3 °C 11.5–15.2

Precipitation4.00 mm/mo 1.80–80.3

Air humidity62.2 % 57.1–63.7

Moisture balance-132 mm/mo -143–-58.9

Vapour deficit744 Pa 706–819

Wind speed1.50 m/s 1.40–2.20

Cloud cover18.4 % 17.0–30.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)