Metaxmeste schrankiana

(Hochenwarth, 1785) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Metaxmeste

At a glance

Occurrence records1 962

Data sources7

Biological traits0

DNA specimens38

eDNA detections34

Sources7 archives

Databases and archives Metaxmeste schrankiana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 962 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 962 records

Environmental DNA1 datasets · 8 countries34 detections

DNA & barcodingBOLD38 specimens

01Narrative

Metaxmeste schrankiana is a species of moth of the family Crambidae described by Siegmund von HochenwarthAlso spelled Sigismund von Hohenwart "Reference summary for Hochenwarth, S. von 1785". AnimalBase. Retrieved January 19, 2018. in 1785. It is found in most of western Europe, including France, the Iberian Peninsula, Scandinavia, Germany, Austria, Switzerland, Greece and the Balkans. The wingspan is 18–23 mm. The larvae feed on Vaccinium myrtillus, Vaccinium uliginosum, Vaccinium vitis-idaea and Calluna vulgaris.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metaxmeste schrankiana has left across the world's sequence archives.

At a glance

DNA specimens38

BINs4

Marker genes1

eDNA detections34

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

4Tmostly conserved

19Tmostly conserved

49Tmostly conserved

56Tmostly conserved

59Cmostly conserved

85Amostly conserved

106Cmostly conserved

127Amostly conserved

205Amostly conserved

217Amostly conserved

220Cvariable

274Cmostly conserved

286Amostly conserved

287Cmostly conserved

292Tmostly conserved

319Tmostly conserved

355Amostly conserved

368Gmostly conserved

379Cmostly conserved

385Tmostly conserved

397Cmostly conserved

400Cmostly conserved

424Amostly conserved

476Amostly conserved

479Tmostly conserved

484Amostly conserved

506Gmostly conserved

512Tmostly conserved

536Tmostly conserved

538Amostly conserved

553Avariable

556Amostly conserved

574Amostly conserved

604Tmostly conserved

622Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes12

BINs4

Most divergent pair7.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eurrhypis guttulalissame family3.8%Eurrhypis pollinalissame family4.1%Metaxmeste phrygialissame genus5.6%Metaxmeste nubicolasame genus5.8%Turania pentodontalissame family6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 962 records

Wild obs. + sensor1 150

Museum / vouchered700

Other112

Range

Area of Occupancy AOO4 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 460≤1 km 343≤10 km 150>10 km 24

977 georeferenced · 173 without coordinates

Open the mapobservation + sensor1 150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 48≤1 km 231≤10 km 303>10 km 85

667 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence700

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	292
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	87
Provincia di Livornolocation not on record	82
NHMOlocation not on record	53
Zürich, CH	46
Salzburg, AT	35
SLU Artdatabankenlocation not on record	17
NTNU-VMlocation not on record	16
Rovaniemi, FI	7
BioFokuslocation not on record	6
Tartu, EE	5
DABUHlocation not on record	5
ZMAAlocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Kuopio, FI	2
NTNU University Museum, Department of Natural Historylocation not on record	1

16 institutions · 663 of 700 vouchered records shown · 37 without an institution code

09Environmental DNA34 detections

Where the DNA of Metaxmeste schrankiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C 3.50–13.9

Seasonal swing summer↔winter20.0 °C

Max temp (day)12.4 °C 6.40–17.9

Min temp (night)3.40 °C -1.60–8.90

Precipitation138 mm/mo 65.6–236

Air humidity62.0 % 58.0–65.3

Moisture balance44.8 mm/mo -38.0–194

Vapour deficit444 Pa 299–628

Wind speed4.30 m/s 2.30–7.20

Cloud cover38.6 % 36.3–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Metaxmeste schrankiana

At a glance

Sources7 archives

At a glance

Record type1 962 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 962 records