Metaxmeste phrygialis

Hübner, 1796 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Metaxmeste

At a glance

Occurrence records1 654

Data sources7

Biological traits0

DNA specimens52

eDNA detections46

Sources7 archives

Databases and archives Metaxmeste phrygialis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 654 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 654 records

Environmental DNA1 datasets · 12 countries46 detections

DNA & barcodingBOLD52 specimens

01Narrative

Metaxmeste phrygialis is a species of moth of the family Crambidae described by Jacob Hübner in 1976. It is found in mountainous areas of Europe, including the Alps. The wingspan is about 15 mm. The moth flies from June to August depending on the location.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metaxmeste phrygialis has left across the world's sequence archives.

At a glance

DNA specimens52

BINs2

Marker genes2

eDNA detections46

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

56Cmostly conserved

118Tvariable

220Cvariable

284Tmostly conserved

304Cvariable

340Tmostly conserved

367Tmostly conserved

415Amostly conserved

424Tvariable

433Amostly conserved

506Amostly conserved

550Avariable

571Cmostly conserved

577Avariable

578Cmostly conserved

653Cmostly conserved

658Cvariable

AACATTATATTTTATTTTCGGAATTTGAGCAGGTATAGTAGGAACTTCATTAAGACTATTAATTCGAGCTGAATTAGGTAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes12

BINs2

Most divergent pair11.9%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metaxmeste nubicolasame genus2.0%Eurrhypis guttulalissame family4.7%Eurrhypis pollinalissame family5.6%Metaxmeste schrankianasame genus5.6%Leucochlaena oditissame order7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★COI-PSEUDO

animal barcode

08Occurrence & distribution

Record type1 654 records

Wild obs. + sensor1 152

Museum / vouchered360

Other142

Range

Area of Occupancy AOO3 992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 362≤1 km 299≤10 km 167>10 km 63

891 georeferenced · 261 without coordinates

Open the mapobservation + sensor1 152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 27≤1 km 186≤10 km 95>10 km 3

311 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence360

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	119
Zürich, CH	73
Salzburg, AT	59
NTNU-VMlocation not on record	24
Tartu, EE	13
NHMOlocation not on record	11
Philadelphia, US	10
European Distributed Institute of Taxonomy (EDIT)location not on record	9
Washington, US	8
BioFokuslocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
Research Collection of Alfred Haslbergerlocation not on record	2
neflocation not on record	2
NMBU:MINAlocation not on record	1
Research Collection of Gabriele Fiumilocation not on record	1
SLU Artdatabankenlocation not on record	1

17 institutions · 350 of 360 vouchered records shown · 10 without an institution code

09Environmental DNA46 detections

Where the DNA of Metaxmeste phrygialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.3 °C 4.30–17.7

Seasonal swing summer↔winter19.7 °C

Max temp (day)16.2 °C 8.50–21.9

Min temp (night)6.20 °C -1.70–12.0

Precipitation105 mm/mo 59.4–244

Air humidity60.4 % 55.7–64.4

Moisture balance10.5 mm/mo -79.5–161

Vapour deficit596 Pa 314–850

Wind speed3.50 m/s 1.60–6.20

Cloud cover37.3 % 28.0–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Metaxmeste phrygialis

At a glance

Sources7 archives

At a glance

Record type1 654 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 654 records