Bathyagonus nigripinnis

Gilbert, 1890 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Agonidae/Bathyagonus

At a glance

Occurrence records2 650

Data sources9

Biological traits7

DNA specimens13

eDNA detections13

Sources9 archives

Databases and archives Bathyagonus nigripinnis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 115 records↗

OBISOcean Biodiversity Information System1 535 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS2 650 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

The blackfin poacher (Bathyagonus nigripinnis, also known as the blackfin starsnout poacher in the United StatesCommon names for Bathyagonus nigripinnis at www.fishbase.org.) is a fish in the family Agonidae (poachers).Bathyagonus nigripinnis at www.fishbase.org. It was described by Charles Henry Gilbert in 1890.Gilbert, C. H., 1890 (1 July) [ref. 1623] A preliminary report on the fishes collected by the steamer Albatross on the Pacific coast of North America during the year 1889, with descriptions of twelve new genera and ninety-two new species. Proceedings of the United States National Museum v. 13 (no. 797): 49-126. It is a marine, boreal water-dwelling fish which is known from the northern Pacific Ocean, including Komandorski Island and Avachin Bay in Russia, St. Mathew Island in the Bering Sea, and Eureka, California, USA. It dwells at a depth range of 18–1290 metres, most often at around 400–700 m, and inhabits soft bottoms. It is known to live for a maximum of 9 years. Males can reach a maximum total length of 24.2 centimetres, but more commonly reach a TL of 20 cm. The Blackfin poacher is preyed on by the Sablefish (Anoplopoma fimbria) and the Aleutian skate (Bathyraja aleutica).Organisms preying on Bathyagonus nigripinnis at www.fishbase.org.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length24.2 cm

Life cycle & reproduction1

Max. longevity108 months

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max1 290 m

Depth min18 m

Vulnerability14.2

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bathyagonus nigripinnis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

576Tmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTAATTCGAGCTGAGCTGAGCCAACCCGGGGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bathyagonus alascanussame genus1.8%Bathyagonus infraspinatussame genus2.5%Odontopyxis trispinosasame family6.6%Agonopsis chiloensissame family8.3%Agonopsis vulsasame family8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~2.48 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.48 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 650 records

Wild obs. + sensor1 952

Museum / vouchered698

Origin

Native140

Range

Area of Occupancy AOO2 892 km²

Depth

0–200 m sunlit168

200–1000 m twilight282

1–4 km midnight33

>4 km abyssal3

median 313.6 m · max 7 050 m · 486 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 265>10 km 16

281 georeferenced · 1 671 without coordinates

Open the mapobservation + sensor1 952

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 1≤10 km 14>10 km 5

20 georeferenced · 678 without coordinates

Open the institutions mapphysical evidence698

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UWFClocation not on record	133
CASlocation not on record	30
Washington, US	22
Vancouver, CA	18
Edmonton, CA	14
Oregon State Universitylocation not on record	10
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	6
Los Angeles, US	5
University of California San Diegolocation not on record	5
Cambridge, US	4
Paris, FR	3
Wuzhou, CN	3
Ann Arbor, US	3
University of Mazandaranlocation not on record	2
FishBaselocation not on record	2
Zoologisches Museum Hamburglocation not on record	2
Texas Cooperative Wildlife Collectionlocation not on record	2
NHMOlocation not on record	2
Copenhagen, DK	2
ArcODlocation not on record	2
Toronto, CA	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Montgomery, US	1
University of Alberta Museumslocation not on record	1
South Kensington, GB	1

25 institutions · 276 of 698 vouchered records shown · 14 without an institution code

09Environmental DNA13 detections

Where the DNA of Bathyagonus nigripinnis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.00 °C 7.50–11.2

Seasonal swing summer↔winter10.6 °C

Max temp (day)12.0 °C 8.00–13.4

Min temp (night)7.00 °C 6.60–9.60

Precipitation59.4 mm/mo 42.5–455

Air humidity67.2 % 61.2–77.2

Moisture balance392 mm/mo

Vapour deficit435 Pa 237–456

Wind speed3.70 m/s

Cloud cover47.4 % 43.8–59.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bathyagonus nigripinnis

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Other traits3

At a glance

At a glance

When this lineage existed

Record type2 650 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 650 records