Agonopsis vulsa

(Jordan & Gilbert, 1880) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Agonidae/Agonopsis

At a glance

Occurrence records731

Data sources8

Biological traits7

DNA specimens6

eDNA detections10

Sources8 archives

Databases and archives Agonopsis vulsa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility383 records↗

OBISOcean Biodiversity Information System348 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS731 records

Environmental DNA3 datasets · 2 countries10 detections

DNA & barcodingBOLD6 specimens

01Narrative

The northern spearnose poacher (Agonopsis vulsa, also known as the window-tailed sea-poacher or the windowtail poacherCommon names for Agonopsis vulsa at www.fishbase.org.) is a fish in the family Agonidae (poachers).Agonopsis vulsa at www.fishbase.org. It was described by David Starr Jordan and Charles Henry Gilbert in 1880, originally under the genus Agonus.Jordan, D. S. and C. H. Gilbert, 1880 (2 Nov.) [ref. 18354] Description of a new agonoid (Agonus vulsus), from the coast of California. Proceedings of the United States National Museum v. 3 (no. 162): 330-332. It is a marine, temperate water-dwelling fish which is known from the eastern Pacific Ocean, including southeastern Alaska to southern California, USA. It dwells at a depth range of 0 to. Males can reach a maximum total length of 20 cm. The northern spearnose poacher is sometimes used as a public aquarium fish.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length20 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max163 m

Depth min0 m

Vulnerability10

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopsis vulsa has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

211Tvariable

319Gmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCTTAATTCGGGCTGAGCTGAGCCAACCCGGGGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopsis chiloensissame genus6.7%Bathyagonus pentacanthussame family8.3%Bathyagonus infraspinatussame family8.7%Bathyagonus nigripinnissame family8.9%Bathyagonus alascanussame family8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~5.24 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5.24 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type731 records

Wild obs. + sensor361

Museum / vouchered370

Origin

Native62

Range

Area of Occupancy AOO1 260 km²

Depth

0–200 m sunlit126

200–1000 m twilight8

1–4 km midnight0

>4 km abyssal0

median 54 m · max 620 m · 134 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 60≤1 km 46≤10 km 13>10 km 1

120 georeferenced · 241 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 8≤10 km 37>10 km 17

62 georeferenced · 308 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UWFClocation not on record	49
Vancouver, CA	32
Los Angeles, US	13
Oregon State Universitylocation not on record	12
CASlocation not on record	9
University of California San Diegolocation not on record	9
Washington, US	7
University of Alberta Museumslocation not on record	5
Chicago, US	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
University of Victorialocation not on record	4
Toronto, CA	4
Cambridge, US	3
Champaign, US	3
Moore Laboratory of Zoology, Occidental Collegelocation not on record	2
New Haven, US	1
FishBaselocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Edmonton, CA	1
Ann Arbor, US	1

20 institutions · 166 of 370 vouchered records shown · 7 without an institution code

09Environmental DNA10 detections

Where the DNA of Agonopsis vulsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 7.70–18.5

Seasonal swing summer↔winter12.8 °C

Max temp (day)15.7 °C 10.4–23.5

Min temp (night)10.9 °C 5.60–15.0

Precipitation61.2 mm/mo 29.0–149

Air humidity61.0 % 60.1–61.8

Moisture balance0.3 mm/mo

Vapour deficit617 Pa 427–829

Wind speed2.70 m/s

Cloud cover40.9 % 31.8–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)