Agonopsis chiloensis

(Jenyns, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Agonidae/Agonopsis

At a glance

Occurrence records616

Data sources7

Biological traits7

DNA specimens7

eDNA detections0

Sources7 archives

Databases and archives Agonopsis chiloensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

OBISOcean Biodiversity Information System312 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS616 records

DNA & barcodingBOLD7 specimens

01Narrative

Agonopsis chiloensis, the snailfish,Common names for Agonopsis chiloensis at www.fishbase.org. is a fish in the family Agonidae (poachers).Agonopsis chiloensis at www.fishbase.org. It was described by Leonard Jenyns in 1840.Jenyns, L., 1840-42 [ref. 2344] Fish. In: The zoology of the voyage of H. M. S. Beagle, under the command of Captain Fitzroy, R. N., during the years 1832 to 1836. London: Smith, Elder, and Co. Issued in 4 parts. i-xvi + 1-172, Pls. 1-29. It is a subtropical, marine fish which is known from the southeastern Pacific and southwestern Atlantic Ocean, including Chile, Patagonia, and Argentina. It is known to dwell at a depth range of 3–400 metres. Males can reach a maximum standard length of 12.5 centimetres. Agonopsis chiloensis is preyed upon by Cottoperca gobio, imperial shag, Pinguipes chilensis, and the narrowmouthed catshark.Organisms preying on Agonopsis chiloensis at www.fishbase.org. It is of no commercial interest to fisheries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max400 m

Depth min3 m

Vulnerability10

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopsis chiloensis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

181Cmostly conserved

550Amostly conserved

625Amostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCTTAATTCGGGCTGAGCTGAGCCAACCCGGGGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes3

BIN1

Most divergent pair0.46%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopsis vulsasame genus6.7%Bathyagonus pentacanthussame family8.0%Bathyagonus nigripinnissame family8.3%Xeneretmus latifronssame family8.4%Bathyagonus alascanussame family8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~11.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin11.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type616 records

Wild obs. + sensor415

Museum / vouchered195

Other6

Origin

Native8

Range

Area of Occupancy AOO1 172 km²

Depth

0–200 m sunlit273

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 89 m · max 379 m · 278 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 6≤1 km 34≤10 km 6>10 km 3

49 georeferenced · 366 without coordinates

Open the mapobservation + sensor415

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 11≤10 km 5>10 km 4

20 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CENPAT-CONICETlocation not on record	18
Zoologisches Museum Hamburglocation not on record	9
FishBaselocation not on record	8
SHOAlocation not on record	7
Los Angeles, US	5
Universidad Austral de Chilelocation not on record	4
Paris, FR	4
IIMyClocation not on record	4
Universidad Católica del Nortelocation not on record	4
University of California San Diegolocation not on record	4
UMAGlocation not on record	3
UWFClocation not on record	3
New Haven, US	2
CASlocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	2
Buenos Aires, AR	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Helsinki, FI	1
IZUA-PMlocation not on record	1
South Kensington, GB	1

20 institutions · 84 of 195 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)