Atrophaneura nox

(Swainson, 1822) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Atrophaneura

At a glance

Occurrence records320

Data sources7

Biological traits0

DNA specimens13

eDNA detections0

Sources7 archives

Databases and archives Atrophaneura nox's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility320 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF320 records

DNA & barcodingBOLD13 specimens

01Narrative

Atrophaneura nox, the Malayan batwing, is a papilionid butterfly found in Java, northern Borneo and Peninsular Malaysia.Akinori Nakanishi, Mohd. Fairus Jalil and Nordin Wahid. Catalogue of Swallowtail Butterflies (Lepidoptera: Papilionidae) at BORNEENSIS pdf

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrophaneura nox has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGTACTTCATTAAGATTATTAATTCGAACTGAATTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrophaneura aidoneussame genus4.3%Atrophaneura luchtisame genus4.7%Atrophaneura sycoraxsame genus4.9%Atrophaneura hagenisame genus5.0%Atrophaneura semperisame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND1

animal barcodemitochondrial

08Occurrence & distribution

Record type320 records

Wild obs. + sensor39

Museum / vouchered281

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 15≤10 km 5>10 km 5

30 georeferenced · 9 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 5≤10 km 74>10 km 138

217 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence281

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogorienselocation not on record	51
Cambridge, US	16
Auckland, NZ	16
Sanda, JP	9
ZRClocation not on record	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Banyoles, ES	2
Zürich, CH	2
New Haven, US	1
Natural History Museum of Utahlocation not on record	1
Tartu, EE	1

11 institutions · 108 of 281 vouchered records shown · 173 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)