Atrophaneura aidoneus — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Atrophaneura

At a glance

Occurrence records45

Data sources7

Biological traits0

DNA specimens8

eDNA detections0

Sources7 archives

Databases and archives Atrophaneura aidoneus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF45 records

DNA & barcodingBOLD8 specimens

01Narrative

Atrophaneura aidoneus, the lesser batwing, is an Asian species of butterfly that belongs to the batwings group of Atrophaneura, comprising tailless black swallowtail butterflies.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrophaneura aidoneus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

67Amostly conserved

506Gmostly conserved

562Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGTACTTCATTGAGATTATTAATTCGAACTGAACTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrophaneura sycoraxsame genus2.7%Atrophaneura luchtisame genus3.3%Atrophaneura hagenisame genus3.8%Atrophaneura priapussame genus4.0%Atrophaneura noxsame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PND1

animal barcodemitochondrial

08Occurrence & distribution

Record type45 records

Wild obs. + sensor40

Museum / vouchered5

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 12≤1 km 10≤10 km 6>10 km 8

36 georeferenced · 4 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 4

5 georeferenced

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	3
Natural History Museum, Tribhuvan Universitylocation not on record	2

2 institutions · 5 of 5 vouchered records shown