Atrophaneura sycorax

(Grose-Smith, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Atrophaneura

At a glance

Occurrence records73

Data sources7

Biological traits0

DNA specimens15

eDNA detections0

Sources7 archives

Databases and archives Atrophaneura sycorax's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF73 records

DNA & barcodingBOLD15 specimens

01Narrative

Atrophaneura sycorax is a species of butterfly from the family Papilionidae that is found from southern Burma to Peninsular Malaysia, and in Sumatra and western Java. The wingspan is 130–140 mm. The wings are black. There is a wide dull-white marking on each of the hindwings. The body is completely covered in yellow hair. Females can be black or dark brown. The wing veins are bordered in white. The larvae feed on Aristolochia species: A. cathcartii, A. coadunata, A. singalangensis and Thottea species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atrophaneura sycorax has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

364Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGTACTTCATTGAGATTATTAATTCGAACTGAATTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrophaneura aidoneussame genus2.7%Atrophaneura luchtisame genus3.5%Atrophaneura kuehnisame genus4.1%Atrophaneura priapussame genus4.1%Atrophaneura hagenisame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND1

animal barcodemitochondrial

08Occurrence & distribution

Record type73 records

Wild obs. + sensor14

Museum / vouchered59

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 3≤10 km 1>10 km 7

13 georeferenced · 1 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 27>10 km 23

50 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogorienselocation not on record	9
Auckland, NZ	5
Zürich, CH	4
ZRClocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Cambridge, US	1

6 institutions · 23 of 59 vouchered records shown · 36 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)