Aspergillus tubingensis

Mosseray · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Aspergillus

At a glance

Occurrence records243

Data sources12

Biological traits0

DNA specimens174

eDNA detections99

Sources12 archives

Databases and archives Aspergillus tubingensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics174 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS51 compounds

Occurrence & distributionGBIF243 records

Environmental DNA2 datasets · 7 countries99 detections

DNA & barcodingBOLD · NCBI174 specimens

Genome at a glanceGoaT · NCBI35 Mbp

01Narrative

Aspergillus tubingensis is a darkly pigmented species of fungus in the genus Aspergillus section Nigri. It is often confused with Aspergillus niger due to their similar morphology and habitat. A. tubingensis is often involved in food spoilage of fruits and wheat, and industrial fermentation. This species is a rare agent of opportunistic infection.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition51 compounds

Compounds documented for Aspergillus tubingensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisnaphthalenes15

Naphthalenes and derivatives10

Miscellaneous meroterpenoids5

Indole-Diterpenoid alkaloids (Penitrems)4

Cyclic peptides3

Documented compounds51 total

Tissue Source Quantified only

Compound	Amount	Source
(16R,17S,20R,21S)-16,17-dimethyl-21-(4-methylpent-3-enyl)-10-azapentacyclo[11.8.0.03,11.04,9.016,21]henicosa-1,3(11),4,6,8,12-hexaen-20-ol	present	LOTUS
(1R,4S,4aR,5R,7S,7aR,8R,9S,11aR)-8-(1H-indol-3-yl)-4,4a,7-trimethyl-9-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,8,9,10,11-dodecahydrobenzo[d]naphthalene-1,5-diol	present	LOTUS
(1R,4S,4aR,7S,7aR,8R,9S,11aS)-1-hydroxy-8-(1H-indol-3-yl)-4,4a,7-trimethyl-9-prop-1-en-2-yl-2,3,4,5,6,7,7a,8,9,10-decahydro-1H-benzo[j]naphthalen-11-one	present	LOTUS
(1S,4R,4aS,7S,14bR)-7-isopropyl-4,4a-dimethyl-2,3,4,4a,5,6,7,9-octahydro-1H-7,14b-ethanobenzo[3,4]cyclohepta[1,2-b]carbazol-1-ol	present	LOTUS
(1S,5S,7R,8S,9R,12R,13S)-14-acetyl-5-hydroxy-9-methyl-4,10-dioxa-14-azapentacyclo[11.7.0.01,5.07,12.015,20]icosa-15,17,19-triene-8-carbaldehyde	present	NPASS
(1S,9S,10R,13R,21R)-8-acetyl-13,16-dimethyl-12-oxa-8,16-diazapentacyclo[8.8.3.01,9.02,7.014,21]henicosa-2,4,6,14-tetraen-19-one	present	NPASS
(1S,9S,10R,13R,21R)-8-acetyl-6-hydroxy-5-methoxy-13,16-dimethyl-12-oxa-8,16-diazapentacyclo[8.8.3.01,9.02,7.014,21]henicosa-2(7),3,5,14-tetraen-19-one	present	NPASS
(2R)-2,5,8-trihydroxy-6-methoxy-2-methyl-3H-benzo[g]chromen-4-one	present	LOTUS
(2R)-2,5-dihydroxy-6,8-dimethoxy-2-methyl-3H-benzo[g]chromen-4-one	present	LOTUS
1,3-Butanedione, 1-(1,3-dihydroxy-6,8-dimethoxy-2-naphthalenyl)-	present	LOTUS

05DNA & barcoding174 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aspergillus tubingensis has left across the world's sequence archives.

At a glance

DNA specimens174

Marker genes5

GenBank sequences10

eDNA detections99

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPZ344972.1 ↗476 bpChina · 2024

ACGT

GGACATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCC …

Aspergillus tubingensis strain BY30 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aspergillus transmontanensissame genus6.3%Penicillium citrinumsame family11.1%Penicillium glabrumsame family12.6%Leptographium procerumsame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_007597 ↗ · 16 protein · 25 tRNA · 2 rRNA

cobnad1orf1orf2nad4atp8atp6nad6cox3cox1atp9nad3cox2nad4Lnad5nad2small subunit ribosomal RNAlarge subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aspergillus tubingensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size35 150 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Aspergillus tubingensis0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type243 records

Wild obs. + sensor5

Museum / vouchered217

Cultivated / captive19

Other2

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2>10 km 2

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence217

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 17 without coordinates

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Scientific Institute of Public Health, Brusselslocation not on record	13
Gujarat Biodiversity Gene Banklocation not on record	4
Sydney Medical Schoollocation not on record	3
National Institute of Biological Resourceslocation not on record	3
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	1
TNMlocation not on record	1

7 institutions · 27 of 217 vouchered records shown · 187 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA99 detections

Where the DNA of Aspergillus tubingensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys2

Countries7

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 10.4–27.7

Seasonal swing summer↔winter14.8 °C

Max temp (day)21.7 °C 13.8–30.7

Min temp (night)14.5 °C 6.70–24.4

Precipitation73.3 mm/mo 27.8–156

Air humidity63.3 % 47.0–64.7

Moisture balance-0.1 mm/mo -118–8.80

Vapour deficit1,032 Pa 495–1,636

Wind speed3.80 m/s 2.20–4.10

Cloud cover36.7 % 12.3–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)