Penicillium citrinum

Thom · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records845

Data sources13

Biological traits0

DNA specimens118

eDNA detections5 082

Sources13 archives

Databases and archives Penicillium citrinum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility802 records↗

OBISOcean Biodiversity Information System43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 082 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics118 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS292 compounds

Occurrence & distributionGBIF · OBIS845 records

Environmental DNA11 datasets · 47 countries5 082 detections

DNA & barcodingBOLD · NCBI118 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Penicillium citrinum is an anamorph, mesophilic fungus species of the genus of Penicillium which produces tanzawaic acid A-D, ACC, Mevastatin, Quinocitrinine A, Quinocitrinine B, and nephrotoxic citrinin.UniProtATCC Penicillium citrinum is often found on moldy citrus fruits and occasionally it occurs in tropical spices and cereals.schimmel-schimmelpilze.de This Penicillium species also causes mortality for the mosquito Culex quinquefasciatus. Because of its mesophilic character, Penicillium citrinum occurs worldwide. The first statin (Mevastatin) was 1970 isolated from this species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition292 compounds

Compounds documented for Penicillium citrinum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Azaphilones63

Cholestane steroids34

Decalins with side chains23

Isocoumarins17

Acridone alkaloids17

Documented compounds292 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Cyclocitrinol	present	LOTUS
(14S,15S)-3,6-dihydroxy-5-[(2S,3S)-3-hydroxybutan-2-yl]-4,12,14,15-tetramethyl-8,16-dioxatetracyclo[7.7.1.02,7.013,17]heptadeca-1(17),2,4,6,9,12-hexaen-11-one	present	LOTUS
(1R,3aR,6R)-1-[(3aS,6S,6aR)-6-[(E,2S,5R)-2,5-dihydroxyhex-3-en-2-yl]-6a-methyl-3a,4,5,6-tetrahydro-1H-pentalen-2-yl]-6-hydroxy-2,3,3a,5,6,7-hexahydro-1H-azulen-4-one	present	LOTUS
(1R,3R,4S)-6,8-dihydroxy-3,4,5-trimethyl-1-(2-oxopropyl)-3,4-dihydro-1H-isochromene-7-carboxylic acid	present	LOTUS
(1R,6S,7S,17S,18R)-4,6,7,15,17,18-hexamethyl-8,11,19-trioxapentacyclo[10.7.1.02,10.05,9.016,20]icosa-2,4,9,12(20),13,15-hexaene-3,14-diol	present	LOTUS
(1S,3R)-6-methoxy-3,7-dimethyl-3,4-dihydro-1H-isochromene-1,8-diol	present	LOTUS
(1S,3R,4S)-1-(4'-hydroxy-phenyl)-3,4-dihydro-3,4,5-trimethyl-1H-2-benzopyran-6,8-diol	present	LOTUS
(2E,4E)-5-[(1R,2R,4aS,6S,8S,8aR)-6-hydroxy-2,6,8-trimethyl-2,4a,5,7,8,8a-hexahydro-1H-naphthalen-1-yl]penta-2,4-dienoic acid	present	LOTUS
(2E,4E)-5-[(1R,2S,4aS,6R,8R,8aR)-6-hydroxy-2,6,8-trimethyl-2,4a,5,7,8,8a-hexahydro-1H-naphthalen-1-yl]penta-2,4-dienoic acid	present	LOTUS
(2R)-1-(2,3-dihydropyrrol-1-yl)-2-methyldecane-1,3-dione	present	LOTUS

05DNA & barcoding118 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium citrinum has left across the world's sequence archives.

At a glance

DNA specimens118

Marker genes5

GenBank sequences10

eDNA detections5 082

Countries47

The DNA barcodea real sequence read deposited for this species

ITSPZ406888.1 ↗486 bpIndia · 2026

ACGT

TTTGCCCGAACCTATTTTGCCTCGGCGGGCCCCGCGCCCGCCGACGGCCCCCCTGAACGCTGTCTGAAGTTGCAGTCTGAGACCTATTAC …

Penicillium citrinum isolate ms5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Penicillium atramentosumsame genus2.7%Penicillium hordeisame genus3.4%Penicillium aurantiogriseumsame genus3.4%Penicillium radicicolasame genus4.1%Penicillium bialowiezensesame genus4.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_047444 ↗ · 16 protein · 24 tRNA · 2 rRNA

rps3cox1atp9nad3cox2ORF349nad4Lnad5nad2cobnad1nad4atp8atp6nad6cox3rrnLrrnS

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium citrinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 121 705 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium citrinum0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96% BUSCO

08Occurrence & distribution

Record type845 records

Wild obs. + sensor35

Museum / vouchered750

Cultivated / captive50

Other10

Origin

Native1

Range

Area of Occupancy AOO1 612 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 12 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 23>10 km 3

27 georeferenced · 8 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced · 746 without coordinates

Open the institutions mapphysical evidence750

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the mapnot free-living50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Institute of Biological Resourceslocation not on record	11
Bronx, US	6
DPIlocation not on record	5
Research Collection of Keith Seifertlocation not on record	4
UFPElocation not on record	3
ARMS-MBONlocation not on record	3
Gujarat Biodiversity Gene Banklocation not on record	3
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	3
Uppsala, SE	2
BDBClocation not on record	1
Pullman, US	1
Universidad Católica de Manizales (UCM)location not on record	1
Sydney Medical Schoollocation not on record	1
PHlocation not on record	1

14 institutions · 45 of 750 vouchered records shown · 673 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 082 detections

Where the DNA of Penicillium citrinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5 082

Studies independent surveys11

Countries47

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 082 detections have coordinates

Open the map47 countries0

IndomalayanMarina/Harbour; semi-industrial; 9.6 - Subti…Industrial port; industrial; 9.4 - Subtidal …AustralasiaAfrotropicNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.0 °C 8.00–29.0

pH6.38 3.60–9.60

Conductivity127 µS/cm 10.0–160,000

Organic carbon1.20 % 0.004–15.0

Water content10.0 % 0–41.1

Nitrate-N7.00 mg/kg 0.145–520

Phosphorus16.0 mg/kg 2.00–590

Clay20.1 % 0.97–75.9

Sand65.9 % 0–97.2

Depth0 m 0–0.2

MarineSoilSodosolTenosolsKandosolDermosolRudosolChromosols

480 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 21.2–26.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)29.3 °C 26.7–32.2

Min temp (night)23.2 °C 15.7–23.8

Precipitation207 mm/mo 35.9–347

Air humidity67.8 % 55.3–71.3

Moisture balance81.3 mm/mo -113–252

Vapour deficit991 Pa 874–1,541

Wind speed1.20 m/s 0.7–3.40

Cloud cover41.3 % 14.5–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 932 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)