Penicillium glabrum

(Wehmer) Westling · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records205

Data sources13

Biological traits0

DNA specimens57

eDNA detections82

Sources13 archives

Databases and archives Penicillium glabrum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

OBISOcean Biodiversity Information System10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF · OBIS205 records

Environmental DNA4 datasets · 4 countries82 detections

DNA & barcodingBOLD · NCBI57 specimens

Genome at a glanceGoaT · NCBI33 Mbp

01Narrative

Penicillium glabrum is a plant pathogen infecting strawberries.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition29 compounds

Compounds documented for Penicillium glabrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Miscellaneous polyketides5

Cucurbitane triterpenoids4

Anthraquinones and anthrones4

Chromones4

Kavalactones and derivatives2

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3R,4R,6S)-6-[(1E,3E)-hepta-1,3-dienyl]-3,4-dihydroxy-2-oxocyclohexane-1-carbaldehyde	present	LOTUS
(2R)-4-methoxy-5-methyl-2-(2-phenylethenyl)-2,3-dihydropyran-6-one	present	LOTUS
(2R)-4-methoxy-5-methyl-2-[(E)-2-phenylethenyl]-2,3-dihydropyran-6-one	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-9,14-dihydroxy-15-[(2R,5S)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-7,7,12,16-tetramethyl-6-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-14-hydroxy-7,7,12,16-tetramethyl-15-[(2R,5S)-2-methyl-5-[2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropan-2-yl]oxolan-2-yl]-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-9-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5R)-2-[[(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-14-hydroxy-15-[(2R,5S)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-7,7,12,16-tetramethyl-9-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-6-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]oxane-3,4,5-triol	present	NPASS
(3S)-6,7-dihydroxy-3-[(Z)-1-hydroxy-3-oxobut-1-enyl]-4-oxo-2,3-dihydrochromene-5-carboxylic acid	present	LOTUS
4,6,7-trihydroxy-3-(3-oxobutanoyl)-2H-chromene-5-carboxylic acid	present	LOTUS
6,7-Dihydroxy-3-(1-hydroxy-3-oxobut-1-enyl)-4-oxo-2,3-dihydrochromene-5-carboxylic acid	present	LOTUS
6,7-Dihydroxy-4-oxo-3-(3-oxobutanoyl)-2,3-dihydrochromene-5-carboxylic acid	present	LOTUS

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium glabrum has left across the world's sequence archives.

At a glance

DNA specimens57

Marker genes2

GenBank sequences10

eDNA detections82

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPX206024.1 ↗492 bpSweden · 2024

ACGT

GTTTATTGTACCTTGTTGCTTCGGTGCGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCCCGGGTCCGCGCGCACCGGAGACACTATTG …

Penicillium glabrum isolate SLU_birch_87 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Penicillium atramentosumsame genus6.1%Penicillium bilaiaesame genus6.1%Penicillium herqueisame genus6.1%Penicillium sclerotiorumsame genus6.7%Penicillium mallochiisame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium glabrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size33 159 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium glabrum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type205 records

Wild obs. + sensor30

Museum / vouchered143

Cultivated / captive26

Other6

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 1≤1 km 2≤10 km 24>10 km 1

28 georeferenced · 2 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 143 records without

Open the institutions mapphysical evidence143

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the mapnot free-living26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Research Collection of Keith Seifertlocation not on record	7
National Institute of Biological Resourceslocation not on record	6
Universidad Nacional de Colombialocation not on record	4
DPIlocation not on record	3
BDBClocation not on record	1
Museo Entomologico de Leonlocation not on record	1

6 institutions · 22 of 143 vouchered records shown · 118 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA82 detections

Where the DNA of Penicillium glabrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys4

Countries4

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map4 countries0

Birch(Hardwood) dowel buried in soil of a co…Pine(Softwood) dowel buried in soil of a mix…Pine(Softwood) dowel buried in soil of a con…Birch(Hardwood) dowel buried in soil of a mi…Spruce(Softwood) dowel buried in soil of a m…Spruce(Softwood) dowel buried in soil of a c…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 1.10–14.5

Seasonal swing summer↔winter27.1 °C

Max temp (day)14.8 °C 2.80–18.3

Min temp (night)7.40 °C -1.10–11.3

Precipitation89.4 mm/mo 68.1–106

Air humidity60.9 % 57.2–70.4

Moisture balance9.70 mm/mo -17.9–54.4

Vapour deficit586 Pa 207–649

Wind speed2.50 m/s 2.20–2.70

Cloud cover58.7 % 48.8–59.0

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)