Arhopalus productus

(LeConte, 1850) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Arhopalus

At a glance

Occurrence records315

Data sources7

Biological traits0

DNA specimens6

eDNA detections2

Sources7 archives

Databases and archives Arhopalus productus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility315 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF315 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD6 specimens

01Narrative

Arhopalus productus is a species of beetle in the family Cerambycidae.Bezark, Larry G. A Photographic Catalog of the Cerambycidae of the World . Retrieved 7 July 2012. It was described by John Lawrence LeConte in 1850.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhopalus productus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

22Amostly conserved

85Cvariable

193Cmostly conserved

220Gmostly conserved

319Tmostly conserved

421Tmostly conserved

640Tmostly conserved

AACATTATATTTCATTTTTGGAGCTTGATCAAGAATAGTAGGAACTTCACTAAGATTATTAATTCGATCAGAATTAGGAAGACCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhopalus asperatussame genus9.4%Arhopalus ferussame genus10.7%Arhopalus foveicollissame genus10.8%Cephalallus unicolorsame family11.2%Lasconotus subcostulatussame order12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type315 records

Wild obs. + sensor232

Museum / vouchered83

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 152≤1 km 12≤10 km 11>10 km 17

192 georeferenced · 40 without coordinates

Open the mapobservation + sensor232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 2≤10 km 4>10 km 2

10 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	43
University of Alberta Museums (UAM)location not on record	20
WIlocation not on record	8
Natural History Museum of Utahlocation not on record	3
San Diego, US	2
Colorado State Universitylocation not on record	2
Toronto, CA	2
Santa Barbara Museum of Natural Historylocation not on record	1
OSUClocation not on record	1
Champaign, US	1

10 institutions · 83 of 83 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Arhopalus productus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)