Arhopalus asperatus

(LeConte, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Arhopalus

At a glance

Occurrence records525

Data sources7

Biological traits0

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Arhopalus asperatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility525 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF525 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Arhopalus asperatus is a species of beetle in the family Cerambycidae.Bezark, Larry G. A Photographic Catalog of the Cerambycidae of the World. Retrieved 7 July 2012. It was described by John Lawrence LeConte in 1859. The beetles vary from 18 to 33 mm in length, and have antennae of around 50% to 75% of the body length.Arhopalus asperatus – A Common Longhorned Beetle Colorado Insects of Interest

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhopalus asperatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

3Cmostly conserved

28Amostly conserved

40Amostly conserved

55Amostly conserved

85Tvariable

212Tmostly conserved

214Amostly conserved

220Tmostly conserved

223Tmostly conserved

227Amostly conserved

229Amostly conserved

230Gmostly conserved

234Tmostly conserved

235Cmostly conserved

238Tmostly conserved

240Gmostly conserved

241Amostly conserved

242Amostly conserved

245Amostly conserved

246Amostly conserved

247Tmostly conserved

248Amostly conserved

249Amostly conserved

251Amostly conserved

252Tmostly conserved

253Gvariable

254Amostly conserved

255Gmostly conserved

256Amostly conserved

257Tmostly conserved

258Tmostly conserved

259Tmostly conserved

260Tmostly conserved

264Tmostly conserved

271Cmostly conserved

286Amostly conserved

316Amostly conserved

340Cmostly conserved

400Amostly conserved

430Amostly conserved

433Gmostly conserved

463Cmostly conserved

469Tmostly conserved

496Amostly conserved

511Amostly conserved

553Cmostly conserved

616Cmostly conserved

631Gmostly conserved

637Amostly conserved

AACATTATACTTTATTTTTGGAGCATGAGCAAGAATAGTAGGAACTTCACTAAGATTACTAATTCGTTCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes5

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhopalus foveicollissame genus4.6%Arhopalus ferussame genus9.0%Arhopalus productussame genus9.4%Bitoma crenatasame order13.1%Lacinipolia loreasame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type525 records

Wild obs. + sensor403

Museum / vouchered122

Range

Area of Occupancy AOO1 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 254≤1 km 30≤10 km 23>10 km 31

338 georeferenced · 65 without coordinates

Open the mapobservation + sensor403

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 8

15 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence122

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	85
San Diego, US	8
University of Alberta Museums (UAM)location not on record	7
Santa Barbara Museum of Natural Historylocation not on record	6
Natural History Museum of Utahlocation not on record	6
Colorado State Universitylocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
University of Central Floridalocation not on record	2
Utah State University Eastern Prehistoric Museumlocation not on record	1
Champaign, US	1

10 institutions · 122 of 122 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Arhopalus asperatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 9.90–22.3

Seasonal swing summer↔winter22.6 °C

Max temp (day)21.5 °C 15.8–28.4

Min temp (night)11.6 °C 4.50–15.6

Precipitation39.7 mm/mo 21.1–71.7

Air humidity51.0 % 44.7–54.7

Moisture balance-81.2 mm/mo -123–-30.1

Vapour deficit886 Pa 564–1,527

Wind speed2.60 m/s 1.90–3.70

Cloud cover32.3 % 17.4–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)