Arhopalus ferus

(Mulsant, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Arhopalus

At a glance

Occurrence records3 244

Data sources6

Biological traits2

DNA specimens40

eDNA detections38

Sources6 archives

Databases and archives Arhopalus ferus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 244 records

Environmental DNA1 datasets · 8 countries38 detections

DNA & barcodingBOLD40 specimens

01Narrative

De zwarte grootoogboktor is een keversoort uit de familie van de boktorren (Cerambycidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1839 door Mulsant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)omnivore

Feeding guild (larval)xylophagous

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhopalus ferus has left across the world's sequence archives.

At a glance

DNA specimens40

BINs2

Marker genes1

eDNA detections38

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 102 variable positions, in barcode order

3Tmostly conserved

8Tmostly conserved

20Gmostly conserved

26Amostly conserved

38Tmostly conserved

50Gmostly conserved

53Tmostly conserved

54Cmostly conserved

56Tmostly conserved

68Amostly conserved

77Tmostly conserved

80Cmostly conserved

98Avariable

131Tmostly conserved

161Amostly conserved

167Cmostly conserved

176Tmostly conserved

179Gmostly conserved

185Cmostly conserved

203Tmostly conserved

206Amostly conserved

212Tmostly conserved

215Gvariable

218Amostly conserved

221Tmostly conserved

227Amostly conserved

233Tmostly conserved

236Cmostly conserved

245Tmostly conserved

260Amostly conserved

269Tmostly conserved

272Tmostly conserved

275Tmostly conserved

285Tmostly conserved

287Amostly conserved

310Amostly conserved

311Tmostly conserved

314Gmostly conserved

320Gmostly conserved

323Tmostly conserved

326Gmostly conserved

332Tmostly conserved

335Amostly conserved

341Tmostly conserved

344Tmostly conserved

345Cmostly conserved

347Tmostly conserved

350Tmostly conserved

351Gmostly conserved

371Amostly conserved

389Tmostly conserved

398Amostly conserved

399Cmostly conserved

401Tmostly conserved

422Amostly conserved

431Gmostly conserved

446Cmostly conserved

449Amostly conserved

455Tmostly conserved

467Gvariable

470Amostly conserved

472Amostly conserved

473Tvariable

476Amostly conserved

482Tmostly conserved

483Tmostly conserved

488Tmostly conserved

491Tmostly conserved

498Tmostly conserved

500Amostly conserved

503Tmostly conserved

506Amostly conserved

509Gmostly conserved

515Amostly conserved

516Amostly conserved

521Tmostly conserved

524Tmostly conserved

537Cmostly conserved

539Tmostly conserved

546Tmostly conserved

551Gmostly conserved

555Tmostly conserved

557Amostly conserved

560Tmostly conserved

563Tmostly conserved

572Tmostly conserved

576Cmostly conserved

578Tmostly conserved

584Avariable

587Cmostly conserved

617Amostly conserved

618Gmostly conserved

623Tmostly conserved

629Tmostly conserved

632Cmostly conserved

635Amostly conserved

638Tmostly conserved

639Tmostly conserved

641Amostly conserved

644Cmostly conserved

651Tmostly conserved

653Gmostly conserved

CATTATATTTTATTTTTGGGGCATGAGCAAGAATAGTTGGAACTTCTTTGAGTCTTTTAATTCGTTCAGAATTAGGTAGCCCTGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes11

BINs2

Most divergent pair17.1%

N.AmericaEuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arhopalus foveicollissame genus9.0%Arhopalus asperatussame genus9.0%Arhopalus productussame genus10.7%Cephalallus unicolorsame family12.3%Mycetophagus multipunctatussame order12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 244 records

Wild obs. + sensor2 452

Museum / vouchered509

Other283

Origin

Native45

Range

Area of Occupancy AOO6 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 796≤1 km 344≤10 km 562>10 km 168

1 870 georeferenced · 582 without coordinates

Open the mapobservation + sensor2 452

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 10≤1 km 88≤10 km 231>10 km 5

334 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence509

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	101
Brussels, BE	83
Auckland, NZ	67
Vitoria, ES	44
New Zealand Arthropod Collectionlocation not on record	40
Helsinki, FI	36
Natural History Museum Rotterdamlocation not on record	19
Tartu, EE	17
CBDClocation not on record	7
Muzeum Górnośląskie w Bytomiulocation not on record	7
Geneva, CH	6
DPIlocation not on record	6
Tilburg, NL	5
NCMGlocation not on record	5
SLU Artdatabankenlocation not on record	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Stockholm, SE	3
Fergusson College (Autonomous)location not on record	3
RBINS-Scientific Heritagelocation not on record	3
Musee d'Histoire Naturallelocation not on record	2
Paro, BT	2
IFR-DNFlocation not on record	2
MSNMlocation not on record	2
Nijmegen, NL	1
Museo Entomologico de Leonlocation not on record	1
Universita di Firenze, Museo di Storia Naturalelocation not on record	1
NMOKlocation not on record	1
MZLUlocation not on record	1

28 institutions · 474 of 509 vouchered records shown · 35 without an institution code

09Environmental DNA38 detections

Where the DNA of Arhopalus ferus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C -0.6–21.8

Seasonal swing summer↔winter15.2 °C

Max temp (day)14.2 °C 1.10–24.9

Min temp (night)8.60 °C -4.80–19.2

Precipitation53.4 mm/mo 23.1–97.5

Air humidity58.7 % 55.4–64.6

Moisture balance13.7 mm/mo

Vapour deficit584 Pa 224–1,088

Wind speed3.70 m/s

Cloud cover45.2 % 34.4–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arhopalus ferus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type3 244 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 244 records