Argyrotaenia tabulana

Freeman, 1944 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records222

Data sources7

Biological traits0

DNA specimens35

eDNA detections0

Sources7 archives

Databases and archives Argyrotaenia tabulana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF222 records

DNA & barcodingBOLD35 specimens

01Narrative

Argyrotaenia tabulana, the jack pine tube moth or lodgepole needletier moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alabama, Arkansas, British Columbia, Florida, Georgia, Indiana, Louisiana, Maine, Maryland, Massachusetts, Mississippi, New Jersey, New York, North Carolina, Ohio, Oklahoma, Pennsylvania, South Carolina and West Virginia.mothphotographersgroup The wingspan is about 14–20 mm. Adults have been recorded on wing from January to October. The larvae feed on Picea glauca, Picea engelmannii, Pinus species (including Pinus albicaulis, Pinus banksiana, Pinus contorta, Pinus monticola, Pinus ponderosa), Pseudotsuga menziesii and Tsuga heterophylla.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia tabulana has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

100Tvariable

106Tmostly conserved

212Tvariable

271Cmostly conserved

274Tmostly conserved

287Tmostly conserved

400Tmostly conserved

412Cmostly conserved

517Amostly conserved

550Amostly conserved

562Avariable

616Tmostly conserved

619Cmostly conserved

634Tmostly conserved

643Cmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes17

BIN1

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia pinatubanasame genus1.5%Argyrotaenia occultanasame genus1.7%Argyrotaenia velutinanasame genus2.1%Argyrotaenia repertanasame genus2.4%Argyrotaenia hodgesisame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type222 records

Wild obs. + sensor116

Museum / vouchered106

Range

Area of Occupancy AOO464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 53≤1 km 25≤10 km 5>10 km 10

93 georeferenced · 23 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 13>10 km 5

19 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	62
New Haven, US	16
University of California, Davislocation not on record	11
CUlocation not on record	8
North Carolina State University Insect Museumlocation not on record	4
East Lansing, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Natural History Museum of Utahlocation not on record	1

8 institutions · 105 of 106 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)