Argyrotaenia pinatubana

(Kearfott, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records1 400

Data sources8

Biological traits0

DNA specimens80

eDNA detections1

Sources8 archives

Databases and archives Argyrotaenia pinatubana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 400 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 400 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD80 specimens

01Narrative

Argyrotaenia pinatubana, the pine tube moth, is a species of moth of the family Tortricidae. It is found in eastern North America, from Canada south to Florida and west to Wisconsin.Pest Fact Sheets from Penn State and PDA Infestation The wingspan is 12–17 mm.Bug Guide The forewings are reddish-orange with two off-white oblique lines. The hindwings are smoky coloured. There are two generations per each year. The larvae mainly feed on Pinus strobus. They are pale green larvae and can reach a length of about 12 mm. Young larvae spin silk and tie five to twenty needles together to form a tube. The larvae live within this tube. When the tube walls have been mostly eaten down, the larvae will abandon their tubes and begin constructing new ones. The species overwinters in the pupal stage within the tube.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia pinatubana has left across the world's sequence archives.

At a glance

DNA specimens80

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

29Gmostly conserved

101Gmostly conserved

160Amostly conserved

202Tmostly conserved

250Tmostly conserved

280Cmostly conserved

311Amostly conserved

346Amostly conserved

400Cmostly conserved

412Cmostly conserved

482Tmostly conserved

483Cmostly conserved

508Cmostly conserved

526Gmostly conserved

577Gmostly conserved

580Amostly conserved

581Cmostly conserved

616Tmostly conserved

622Amostly conserved

652Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes7

BIN1

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia ljungianasame genus1.5%Argyrotaenia tabulanasame genus1.5%Argyrotaenia floridanasame genus1.7%Argyrotaenia velutinanasame genus2.1%Argyrotaenia repertanasame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 400 records

Wild obs. + sensor1 151

Museum / vouchered249

Range

Area of Occupancy AOO2 624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 642≤1 km 132≤10 km 18>10 km 49

841 georeferenced · 310 without coordinates

Open the mapobservation + sensor1 151

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 11≤10 km 56>10 km 4

71 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence249

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	108
St. Paul, US	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	22
New Haven, US	21
East Lansing, US	11
Mississippi State, US	8
OSUClocation not on record	2
Cambridge, US	1
CUlocation not on record	1
University of Alberta Museums (UAM)location not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
University of California, Davislocation not on record	1

13 institutions · 211 of 249 vouchered records shown · 38 without an institution code

09Environmental DNA1 detections

Where the DNA of Argyrotaenia pinatubana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 17.6–17.6

Seasonal swing summer↔winter29.5 °C

Max temp (day)22.2 °C

Min temp (night)13.1 °C

Precipitation124 mm/mo

Air humidity60.4 %

Moisture balance-5.60 mm/mo

Vapour deficit794 Pa

Wind speed2.20 m/s

Cloud cover48.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyrotaenia pinatubana

At a glance

Sources8 archives

At a glance

Record type1 400 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 400 records