Argyrotaenia repertana

Freeman, 1944 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyrotaenia

At a glance

Occurrence records45

Data sources7

Biological traits0

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Argyrotaenia repertana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF45 records

DNA & barcodingBOLD5 specimens

01Narrative

Argyrotaenia repertana is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Maine, Manitoba, Massachusetts, New Brunswick, Nova Scotia, Quebec, Saskatchewan and Washington.mothphotographersgroup, 1961: Descriptions of and Notes on North and Central American Species of Argyrotaenia, with the description of a new Genus (Lepidoptera: Tortricidae). American Museum Novitates 2048: 1-42. Full article: [1]. The wingspan is about 16–17 mm. Adults have been recorded on wing from May to August. The larvae feed on Aralia species, Rhododendron canadense, Morella caroliniensis, Myrica gale, Aronia melanocarpa, Prunus pensylvanica and Salix species.Brown, J. W., G. Robinson & J. A. Powell. 2008. Food plant database of the leafrollers of the world (Lepidoptera: Tortricidae) (Version 1.0)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrotaenia repertana has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACATTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyrotaenia floridanasame genus2.3%Argyrotaenia tabulanasame genus2.4%Argyrotaenia ljungianasame genus2.7%Argyrotaenia pinatubanasame genus2.7%Argyrotaenia occultanasame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor29

Museum / vouchered16

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 20≤1 km 4

24 georeferenced · 5 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	7
New Haven, US	4
Cornell University Insect Collectionlocation not on record	3
East Lansing, US	1
St. Paul, US	1

5 institutions · 16 of 16 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)