Argyresthia albistria

Haworth, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records2 770

Data sources8

Biological traits0

DNA specimens74

eDNA detections164

Sources8 archives

Databases and archives Argyresthia albistria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 770 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI164 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 770 records

Environmental DNA3 datasets · 11 countries164 detections

DNA & barcodingBOLD74 specimens

Genome at a glanceGoaT · NCBI≈371 Mbp

01Narrative

De sleedoornpedaalmot is een vlinder uit de familie van de pedaalmotten (Argyresthiidae). De spanwijdte van de vlinder bedraagt 9 tot 12 millimeter. Het vlindertje komt verspreid over Europa voor. De soort overwintert als rups.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia albistria has left across the world's sequence archives.

At a glance

DNA specimens74

BINs1

Marker genes1

eDNA detections164

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus71 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

38Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACATCTTTAAGATTAATAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes3

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia pulchellasame genus5.0%Argyresthia oreasellasame genus5.2%Argyresthia conjugellasame genus5.3%Argyresthia pygmaeellasame genus5.3%Argyresthia curvellasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Argyresthia albistria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈370 518 547 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argyresthia albistria0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness88% BUSCO

08Occurrence & distribution

Record type2 770 records

Wild obs. + sensor2 253

Museum / vouchered455

Other62

Origin

Native3

Range

Area of Occupancy AOO4 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 1 059≤1 km 553≤10 km 501>10 km 5

2 118 georeferenced · 135 without coordinates

Open the mapobservation + sensor2 253

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 172≤1 km 91≤10 km 24>10 km 17

304 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence455

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	118
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	62
SLU Artdatabankenlocation not on record	51
NHMOlocation not on record	36
Provincia di Livornolocation not on record	31
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	29
Tartu, EE	22
Oulu, FI	17
Stockholm, SE	16
Nijmegen, NL	8
DABUHlocation not on record	7
South Kensington, GB	5
Salzburg, AT	4
ZSMlocation not on record	3
Kuopio, FI	2
Tilburg, NL	2
Natural History Museum, Londonlocation not on record	2
Metsähallituslocation not on record	1
Rovaniemi, FI	1
BioFokuslocation not on record	1
University of Kaiserslauternlocation not on record	1
MZLUlocation not on record	1

22 institutions · 420 of 455 vouchered records shown · 35 without an institution code

09Environmental DNA164 detections

Where the DNA of Argyresthia albistria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found164

Studies independent surveys3

Countries11

Verifiable raw sequence linked100

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 164 detections have coordinates

Open the map11 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.6–18.5

Seasonal swing summer↔winter18.4 °C

Max temp (day)20.7 °C 16.9–22.5

Min temp (night)13.5 °C 8.60–15.6

Precipitation59.3 mm/mo 52.2–96.8

Air humidity60.7 % 58.2–62.9

Moisture balance-50.0 mm/mo -83.1–0.5

Vapour deficit760 Pa 583–888

Wind speed3.30 m/s 2.30–5.50

Cloud cover42.5 % 34.7–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 163 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia albistria

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 770 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 770 records