Argis lar

(Owen, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Crangonidae/Argis

At a glance

Occurrence records1 191

Data sources6

Biological traits2

DNA specimens46

eDNA detections47

Sources6 archives

Databases and archives Argis lar's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility623 records↗

OBISOcean Biodiversity Information System568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 191 records

Environmental DNA2 datasets · 3 countries47 detections

DNA & barcodingBOLD46 specimens

01Narrative

Argis lar is een garnalensoort uit de familie van de Crangonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1839 door Owen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argis lar has left across the world's sequence archives.

At a glance

DNA specimens46

BINs4

Marker genes1

eDNA detections47

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P569 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

8Tvariable

92Avariable

95Gvariable

113Amostly conserved

116Avariable

152Gmostly conserved

173Gvariable

212Avariable

248Amostly conserved

254Cvariable

260Gvariable

263Cmostly conserved

284Amostly conserved

344Gvariable

410Tmostly conserved

428Gmostly conserved

434Amostly conserved

455Cmostly conserved

476Tmostly conserved

491Cmostly conserved

492Tvariable

518Cvariable

533Gvariable

536Amostly conserved

554Amostly conserved

GCTTAATTGGAAATGATCAAATTTATAATGTAGTTGTGACAGCCCATGCTTTTGTAATAATTTTCTTTATAGTTATACCCATTCTTATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes28

BINs3

Most divergent pair3.9%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argis alaskensissame genus8.4%Argis toyamaensissame genus9.0%Argis dentatasame genus10.2%Crangon crangonsame family17.0%Crangon allmannisame family17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 191 records

Wild obs. + sensor266

Museum / vouchered925

Range

Area of Occupancy AOO1 244 km²

Depth

0–200 m sunlit141

200–1000 m twilight9

1–4 km midnight0

>4 km abyssal0

median 40.2 m · max 426 m · 150 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 30

30 georeferenced · 236 without coordinates

Open the mapobservation + sensor266

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 6≤1 km 3≤10 km 5>10 km 4

18 georeferenced · 907 without coordinates

Open the institutions mapphysical evidence925

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	363
National Institute of Biological Resourceslocation not on record	40
CASlocation not on record	25
Edmonton, CA	23
	14
Washington, US	11
Cambridge, US	5
Stockholm, SE	4
Victoria, CA	4
Maurice Lamontagne Institutelocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
The Atlantic reference Centrelocation not on record	1

15 institutions · 498 of 925 vouchered records shown · 16 without an institution code

09Environmental DNA47 detections

Where the DNA of Argis lar was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys2

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map3 countries0

Bering Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 3.50–25.7

Seasonal swing summer↔winter22.0 °C

Max temp (day)11.1 °C 4.20–27.9

Min temp (night)9.90 °C 2.80–22.6

Precipitation96.8 mm/mo 18.7–206

Air humidity64.8 % 64.8–74.8

Vapour deficit439 Pa 197–1,162

Cloud cover49.1 % 49.1–62.6

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argis lar

At a glance

Sources6 archives

Habitat & environment2

At a glance

Record type1 191 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 191 records