Argis dentata

(M.J.Rathbun, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Crangonidae/Argis

At a glance

Occurrence records10 768

Data sources7

Biological traits2

DNA specimens56

eDNA detections435

Sources7 archives

Databases and archives Argis dentata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 439 records↗

OBISOcean Biodiversity Information System7 329 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI435 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~17.04 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS10 768 records

Environmental DNA3 datasets · 2 countries435 detections

DNA & barcodingBOLD56 specimens

Genome at a glanceGoaT17 Gbp

01Narrative

Argis dentata is een garnalensoort uit de familie van de Crangonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1902 door Rathbun.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argis dentata has left across the world's sequence archives.

At a glance

DNA specimens56

BINs3

Marker genes1

eDNA detections435

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

2Tmostly conserved

11Tmostly conserved

12Amostly conserved

14Tmostly conserved

32Cmostly conserved

83Cmostly conserved

86Gmostly conserved

95Tmostly conserved

173Gmostly conserved

239Gmostly conserved

269Tmostly conserved

317Cmostly conserved

323Amostly conserved

345Cmostly conserved

368Cmostly conserved

426Cmostly conserved

494Amostly conserved

506Gmostly conserved

533Amostly conserved

CTTTATATTTTATTTTTGGTGCGTGATCCGGCATAGTAGGAACCGCCCTAAGTTTATTAATTCGAGCTGAACTTGGTTCCCCCGGGAGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes5

BINs3

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argis toyamaensissame genus6.2%Argis larsame genus10.2%Argis alaskensissame genus11.4%Crangon crangonsame family15.9%Neocrangon communissame family16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Argis dentata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size17 036 760 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Argis dentata17.04 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type10 768 records

Wild obs. + sensor10 010

Museum / vouchered758

Range

Area of Occupancy AOO25 800 km²

Depth

0–200 m sunlit5 783

200–1000 m twilight943

1–4 km midnight4

>4 km abyssal0

median 129.9 m · max 1 455 m · 6 730 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 2 964≤1 km 571≤10 km 28>10 km 1

3 564 georeferenced · 6 446 without coordinates

Open the mapobservation + sensor10 010

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 10≤1 km 1≤10 km 3>10 km 10

24 georeferenced · 734 without coordinates

Open the institutions mapphysical evidence758

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	433
CASlocation not on record	53
Assiniboine Park Conservancylocation not on record	32
Toronto, CA	28
Maurice Lamontagne Institutelocation not on record	24
Edmonton, CA	16
Washington, US	12
The Atlantic reference Centrelocation not on record	10
Cambridge, US	9
Victoria, CA	5
The Manitoba Museumlocation not on record	4
Saint John, CA	4
Dalhousie University, Dept of Fisheries and Oceanslocation not on record	3
Santa Barbara Museum of Natural Historylocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
ArcODlocation not on record	1
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	1

17 institutions · 637 of 758 vouchered records shown · 16 without an institution code

09Environmental DNA435 detections

Where the DNA of Argis dentata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found435

Studies independent surveys3

Countries2

Verifiable raw sequence linked383

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 435 detections have coordinates

Open the map2 countries0

MarineGulf of St. Lawrence

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 3.70–11.4

Seasonal swing summer↔winter35.6 °C

Max temp (day)10.2 °C 4.80–15.5

Min temp (night)4.10 °C 2.00–8.80

Precipitation89.4 mm/mo 31.1–116

Air humidity61.6 % 59.3–66.2

Moisture balance48.9 mm/mo

Vapour deficit415 Pa 232–521

Wind speed4.70 m/s

Cloud cover51.2 % 48.6–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 430 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argis dentata

At a glance

Sources7 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Record type10 768 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 768 records