Argis alaskensis

(Kingsley, 1883) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Crangonidae/Argis

At a glance

Occurrence records994

Data sources6

Biological traits2

DNA specimens8

eDNA detections9

Sources6 archives

Databases and archives Argis alaskensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility418 records↗

OBISOcean Biodiversity Information System576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS994 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD8 specimens

01Narrative

Argis alaskensis is een garnalensoort uit de familie van de Crangonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1883 door Kingsley.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argis alaskensis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

GGCACCTTATATTTTATTTTTGGTGCTTGATCCGGTATAGTAGGGACCGCCCTAAGTTTATTAATTCGAGCTGAACTTGGCTCTCCCGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argis larsame genus8.4%Argis toyamaensissame genus11.2%Argis dentatasame genus11.4%Crangon crangonsame family16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type994 records

Wild obs. + sensor904

Museum / vouchered86

Other4

Range

Area of Occupancy AOO1 680 km²

Depth

0–200 m sunlit77

200–1000 m twilight9

1–4 km midnight0

>4 km abyssal0

median 103 m · max 266.5 m · 86 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 904 records without

Open the mapobservation + sensor904

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 86 records without

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	41
CASlocation not on record	11
Washington, US	4
Edmonton, CA	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
Toronto, CA	2
Royal British Columbia Museumlocation not on record	2

8 institutions · 67 of 86 vouchered records shown · 5 without an institution code

09Environmental DNA9 detections

Where the DNA of Argis alaskensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 9.20–17.7

Seasonal swing summer↔winter8.50 °C

Max temp (day)11.1 °C 10.0–19.7

Min temp (night)8.70 °C 8.20–16.1

Precipitation117 mm/mo 38.6–134

Air humidity65.0 % 60.2–65.6

Vapour deficit424 Pa 400–808

Cloud cover41.4 % 35.7–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)