Argiope hoiseni

Tan, 2018 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records15

Data sources6

Biological traits28

DNA specimens11

eDNA detections11

Sources6 archives

Databases and archives Argiope hoiseni's data was compiled from.

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider Trait DBMasaryk University28 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources28 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

SourcesTan 2018

Morphometry28

Abdomen length4.3 mm

Body length7.4 mm

Cephalothorax length3.1 mm

Cephalothorax width2.8 mm

Femur I length4.1 mm

Femur II length4.1 mm

Femur III length2.8 mm

Femur IV length4.4 mm

Leg I length15.6 mm

Leg II length14.3 mm

Leg III length7.7 mm

Leg IV length13.2 mm

Metatarsus I length5.5 mm

Metatarsus II length4.1 mm

Metatarsus III length1.8 mm

Metatarsus IV length3.8 mm

Patella I length1.5 mm

Patella II length1.7 mm

Patella III length0.9 mm

Patella IV length1.3 mm

Tarsus I length1.2 mm

Tarsus II length1.2 mm

Tarsus III length0.8 mm

Tarsus IV length1.1 mm

Tibia I length3.3 mm

Tibia II length3.2 mm

Tibia III length1.4 mm

Tibia IV length2.6 mm

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope hoiseni has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P521 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

4Tvariable

79Cvariable

97Tmostly conserved

175Tmostly conserved

180Cvariable

205Tmostly conserved

211Cmostly conserved

214Tmostly conserved

253Tmostly conserved

271Cmostly conserved

274Avariable

313Cvariable

338Tmostly conserved

343Cmostly conserved

370Cvariable

406Avariable

424Cmostly conserved

481Gmostly conserved

499Gmostly conserved

517Cvariable

AGTTGAAATGGGAGTAGGGGCAGGATGGACTGTATATCCTCCTTTAGCAGGATTGGAAGGTCATTCTGGAAGATCTGTCGATTTTGCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BINs0

Most divergent pair3.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope appensasame genus8.7%Argiope keyserlingisame genus9.1%Argiope aemulasame genus10.1%Argiope pulchellasame genus10.2%Argiope modestasame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type15 records

Wild obs. + sensor7

Museum / vouchered8

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 2≤1 km 3≤10 km 1>10 km 1

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Guelphlocation not on record	5
AHOIlocation not on record	2
UTARlocation not on record	1

3 institutions · 8 of 8 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Argiope hoiseni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter0.9 °C

Max temp (day)30.4 °C

Min temp (night)22.0 °C

Precipitation309 mm/mo

Air humidity68.8 %

Moisture balance162 mm/mo

Vapour deficit1,043 Pa

Wind speed0.7 m/s

Cloud cover49.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)