Argiope argentata

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records28 985

Data sources11

Biological traits20

DNA specimens109

eDNA detections258

Sources11 archives

Databases and archives Argiope argentata's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 985 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI258 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics109 specimens↗

World Spider Trait DBMasaryk University20 traits · 12 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements12 literature sources20 traits

Occurrence & distributionGBIF28 985 records

Environmental DNA2 datasets · 18 countries258 detections

DNA & barcodingBOLD109 specimens

Genome at a glanceGoaT · NCBI≈1.9 Gbp

01Narrative

Argiope argentata, commonly known as the silver argiope due to the silvery color of its cephalothorax, is a member of the orb-weaver spider family Araneidae. This species resides in arid and warm environments in North America, Central America, the Caribbean and widely across South America. In the USA, it if found at least in Southern California, Florida, Arizona, Texas. A. argentata create stabilimenta and a unique zig-zag in its web design, and it utilizes its UV-reflecting silk to attract pollinating species to prey upon. Like other species of Argiope, its venom is not harmful to humans; however, it can be employed to immobilize its prey. A. argentata engages in sexual cannibalism either mid- or post-copulation. One aspect of particular interest regarding this species is its extinction patterns, which notably have minimal correlation with its population size but rather occur sporadically for the species.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 12 sources

Quesada et al. 2011Craig et al. 2020Cambra et al. 2004Foelix 2011Dias et al. 2010Mansour & Nentwig 1988Gonçalves-Souza et al. 2014Podgaiski et al. 2013 Vandewalle et al. 2010Cardoso et al. 2011Birkhofer & Wolters 2012Pekár et al. 2012a

Morphometry9

Abdomen length♀6.49·Unknown3 mm

Abdomen width3.21 mm

Body mass0.25 mm

Cephalothorax height2.8 mm

Cephalothorax length♀6.23·Unknown4.4 mm

Cephalothorax width♀4.97·Unknown1.4 mm

Femur I length5.44 mm

Femur IV length5.66 mm

Ocular distance0.93 mm

Predation3

Hunting guildorb web

Prey OrderOrthopteroidea

Prey diversity3.35 mm

Ecology2

Circadian activitynocturnal

Microhabitatvegetation

Biomechanics3

Silk strain0.203 mm

Silk strength1 681 mm

Silk toughness174 mm

Life History1

Mortality0.085 mm

Anatomy1

Brain size0.0 mm

Defence1

PredatorPoecilopompilus flavopictus flavopictus

05DNA & barcoding109 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope argentata has left across the world's sequence archives.

At a glance

DNA specimens109

BINs2

Marker genes3

eDNA detections258

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus94 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

1Tmostly conserved

11Tmostly conserved

22Gvariable

49Gmostly conserved

73Gvariable

76Gvariable

79Amostly conserved

97Gmostly conserved

106Tmostly conserved

115Tmostly conserved

127Tmostly conserved

133Tmostly conserved

157Tmostly conserved

181Amostly conserved

190Amostly conserved

205Tmostly conserved

208Amostly conserved

211Gmostly conserved

212Cmostly conserved

217Gvariable

220Tmostly conserved

226Tmostly conserved

280Amostly conserved

293Gmostly conserved

316Amostly conserved

322Gmostly conserved

343Tmostly conserved

355Amostly conserved

356Cmostly conserved

358Gmostly conserved

373Amostly conserved

379Amostly conserved

403Cvariable

421Tmostly conserved

433Amostly conserved

478Avariable

496Tmostly conserved

502Amostly conserved

508Amostly conserved

511Amostly conserved

529Gmostly conserved

565Gmostly conserved

571Cvariable

607Tmostly conserved

613Tmostly conserved

616Cvariable

622Tmostly conserved

628Amostly conserved

631Amostly conserved

634Tmostly conserved

643Gmostly conserved

TACTTTATATTTAATTTTTGGGGCTTGGGCTGCCATAGTAGGTACAGCGATAAGAGTATTAATTCGAATTGAGTTGGGACAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes31

BINs2

Most divergent pair6.5%

N.AmericaOtherEuropeS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope butchkosame genus5.4%Argiope blandasame genus7.4%Argiope keyserlingisame genus8.7%Argiope minutasame genus9.9%Argiope pulchellasame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-3P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Argiope argentata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 900 518 786 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argiope argentata1.9 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type28 985 records

Wild obs. + sensor28 556

Museum / vouchered418

Other11

Origin

Native2

Range

Area of Occupancy AOO47 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 13 905≤1 km 4 871≤10 km 2 681>10 km 1 343

22 800 georeferenced · 5 756 without coordinates

Open the mapobservation + sensor28 556

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 25≤1 km 19≤10 km 89>10 km 63

196 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence418

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	120
Museu Paraense Emílio Goeldilocation not on record	58
Cambridge, US	49
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	20
San Diego, US	17
Ciudad de México, MX	15
Tapachula, MX	14
PUC-RSlocation not on record	13
Frankfurt am Main	10
Mexico City, MX	9
National Biodiversity Institute, Costa Ricalocation not on record	9
Universidad de La Salle (La Salle)location not on record	8
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	8
Denver, US	6
Ohio State University Acarology Laboratorylocation not on record	5
San Francisco, US	5
Museo de Zoologia, Pontificia Universidad Catolica del Ecuadorlocation not on record	4
Albuquerque, US	4
US	4
Chicago, US	4
La Paz, MX	3
Museo Nacional de Historia Natural "Prof. Eugenio de Jesús Marcano"location not on record	3
RMNHlocation not on record	2
Los Angeles, US	2
UNICAMPlocation not on record	2
Champaign, US	2
Alcaldía Municipal de Garzón en Huilalocation not on record	1
Instituto Amazónico de Investigaciones Científicas SINCHI Colección Anfibioslocation not on record	1
Ciudad de México, MX	1
	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Lubbock, US	1
IADIZAlocation not on record	1

33 institutions · 403 of 418 vouchered records shown · 15 without an institution code

09Environmental DNA258 detections

Where the DNA of Argiope argentata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found258

Studies independent surveys2

Countries18

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 258 detections have coordinates

Open the map18 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…ForestChaparral

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 20.6–27.2

Seasonal swing summer↔winter11.3 °C

Max temp (day)29.1 °C 24.5–32.1

Min temp (night)22.4 °C 17.8–24.6

Precipitation157 mm/mo 29.5–189

Air humidity60.3 % 58.7–64.0

Moisture balance-10.3 mm/mo

Vapour deficit1,316 Pa 858–1,490

Wind speed3.30 m/s

Cloud cover32.6 % 20.5–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 229 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argiope argentata

At a glance

Sources11 archives

Morphometry9

Predation3

Ecology2

Biomechanics3

Life History1

Anatomy1

Defence1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type28 985 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type28 985 records