Argiope amoena

L.Koch, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records521

Data sources9

Biological traits3

DNA specimens22

eDNA detections12

Sources9 archives

Databases and archives Argiope amoena's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility521 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

World Spider Trait DBMasaryk University3 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF521 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD22 specimens

Genome at a glanceGoaT2n = 24

01Narrative

Argiope amoena is een spinnensoort in de taxonomische indeling van de wielwebspinnen (Araneidae). Het dier behoort tot het geslacht Argiope. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1878 door Ludwig Carl Christian Koch.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCraig et al. 2020Pekár et al. 2012a

Predation1

Prey diversity3.46 mm

Biomechanics2

Silk strain0.38 mm

Silk strength665 mm

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope amoena has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes13

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

16Tmostly conserved

20Gmostly conserved

24Cmostly conserved

25Tmostly conserved

277Amostly conserved

AAGTTTATATTTAATTTTTGGGGCTTGGGCCGCTATAGTGGGTACAGCTATAAGTGTATTAATCCGAATTGAATTAGGGCAACCTGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope anasujasame genus10.7%Argiope keyserlingisame genus11.8%Argiope minutasame genus12.0%Argiope catenulatasame genus12.0%Argiope submaronicasame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

06Genome at a glanceGoaT

The complete instruction manual Argiope amoena carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type521 records

Wild obs. + sensor478

Museum / vouchered43

Range

Area of Occupancy AOO1 600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 234≤1 km 58≤10 km 23>10 km 57

372 georeferenced · 106 without coordinates

Open the mapobservation + sensor478

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	29
KIBSlocation not on record	6
KBISlocation not on record	4
National Institute of Biological Resourceslocation not on record	2
Cambridge, US	1
Frankfurt am Main	1

6 institutions · 43 of 43 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Argiope amoena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 8.50–22.6

Seasonal swing summer↔winter31.5 °C

Max temp (day)28.1 °C 12.0–28.1

Min temp (night)16.0 °C 3.10–16.0

Precipitation39.0 mm/mo 23.9–222

Air humidity49.5 % 47.2–58.8

Moisture balance-132 mm/mo -132–120

Vapour deficit1,380 Pa 588–1,380

Wind speed4.70 m/s 3.50–4.70

Cloud cover27.8 % 25.6–37.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)