Arge quidia

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records33

Data sources5

Biological traits0

DNA specimens9

eDNA detections10

Sources5 archives

Databases and archives Arge quidia's data was compiled from.

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge quidia has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

88Avariable

184Gvariable

200Gmostly conserved

241Avariable

247Tmostly conserved

322Avariable

415Avariable

577Amostly conserved

628Amostly conserved

GACCCTATATTTTATTTTTGGGATCTGATCAGGAATAGTTGGTCTTTCATTTAGAATAATCATTCGTACTGAATTAAGATCTGTAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge thoracicasame genus10.8%Arge ustulatasame genus11.6%Arge rusticasame genus11.7%Arge ciliarissame genus11.8%Arge expansasame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor22

Museum / vouchered11

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 11≤1 km 9≤10 km 1

21 georeferenced · 1 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 4

7 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Washington, US	1

3 institutions · 10 of 11 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Arge quidia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 15.6–23.0

Seasonal swing summer↔winter25.4 °C

Max temp (day)26.2 °C 18.1–27.7

Min temp (night)16.2 °C 13.6–18.8

Precipitation117 mm/mo 97.0–132

Air humidity58.6 % 56.3–61.1

Moisture balance-44.5 mm/mo -50.4–-4.20

Vapour deficit1,044 Pa 687–1,189

Wind speed2.90 m/s 2.40–4.30

Cloud cover38.8 % 36.6–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)