Arge pagana

(Panzer, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records6 158

Data sources10

Biological traits0

DNA specimens49

eDNA detections27

Sources10 archives

Databases and archives Arge pagana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 158 records

Environmental DNA2 datasets · 10 countries27 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈205 Mbp

01Narrative

Arge pagana is a sawfly in the family Argidae. It is known by the name "large rose sawfly" although the related species Arge ochropus is also known by this name.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge pagana has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections27

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

7Tvariable

40Cvariable

61Cvariable

64Avariable

85Avariable

89Cvariable

100Cvariable

107Avariable

130Cvariable

154Cvariable

190Cvariable

197Avariable

202Cvariable

209Cvariable

211Avariable

214Avariable

232Tvariable

235Avariable

238Cvariable

244Cvariable

260Cvariable

263Cvariable

281Cvariable

313Tvariable

319Amostly conserved

328Gvariable

334Avariable

340Cvariable

361Tvariable

367Avariable

409Avariable

415Tvariable

430Gvariable

448Tvariable

454Avariable

491Tvariable

520Tvariable

529Cvariable

530Cvariable

541Avariable

544Tvariable

550Cvariable

559Tvariable

562Gvariable

589Tvariable

592Cvariable

601Cvariable

616Tvariable

625Avariable

628Tmostly conserved

631Cvariable

640Avariable

649Tvariable

ATTATATTTTATTTTTGGTATTTGAGCAGGAATAATAGGCCTTTCTTTTAGTATAATTATCCGAACAGAATTAAGATCTGTAGGATCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes6

BINs2

Most divergent pair8.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge rusticasame genus11.2%Arge scitasame genus11.3%Arge ochropussame genus12.4%Arge metallicasame genus12.7%Arge melanochrasame genus13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Arge pagana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈204 667 820 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Arge pagana0.20 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome records8–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 81×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.4% BUSCO

08Occurrence & distribution

Record type6 158 records

Wild obs. + sensor5 760

Museum / vouchered397

Cultivated / captive1

Range

Area of Occupancy AOO14 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 2 769≤1 km 680≤10 km 1 206>10 km 141

4 796 georeferenced · 964 without coordinates

Open the mapobservation + sensor5 760

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 45≤1 km 37≤10 km 114>10 km 9

205 georeferenced · 192 without coordinates

Open the institutions mapphysical evidence397

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	167
Zürich, CH	59
Bavarian State Collection of Zoologylocation not on record	16
Tilburg, NL	14
NHMOlocation not on record	13
Bonn, DE	12
BioFokuslocation not on record	11
ZSMlocation not on record	10
DFFW2018location not on record	9
Oulu, FI	8
MZLUlocation not on record	7
Sanda, JP	7
Muzeum Górnośląskie w Bytomiulocation not on record	6
Institute of Zoology Slovak Academy of Scienceslocation not on record	6
SLU Artdatabankenlocation not on record	6
Stockholm, SE	3
Bando, JP	3
Natural History Museum Rotterdamlocation not on record	3
NEFlocation not on record	2
Nijmegen, NL	2
OSUClocation not on record	1
Philadelphia, US	1
DFlocation not on record	1
Toyota city nature sanctuarylocation not on record	1
Tomioka, JP	1
Chiba, JP	1
NCMGlocation not on record	1
University of Oululocation not on record	1

28 institutions · 372 of 397 vouchered records shown · 25 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA27 detections

Where the DNA of Arge pagana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys2

Countries10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 10.4–18.1

Seasonal swing summer↔winter19.2 °C

Max temp (day)17.9 °C 14.9–22.7

Min temp (night)11.2 °C 4.60–13.5

Precipitation84.5 mm/mo 60.8–143

Air humidity58.8 % 57.7–63.1

Moisture balance-33.8 mm/mo -54.9–38.6

Vapour deficit656 Pa 547–872

Wind speed3.20 m/s 1.80–4.40

Cloud cover40.0 % 33.9–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arge pagana

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type6 158 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 158 records