Arge ochropus

(Gmelin, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records5 204

Data sources9

Biological traits0

DNA specimens46

eDNA detections30

Sources9 archives

Databases and archives Arge ochropus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 204 records

Environmental DNA1 datasets · 12 countries30 detections

DNA & barcodingBOLD46 specimens

Genome at a glanceGoaT · NCBI≈240 Mbp

01Narrative

Arge ochropus, the rose sawfly, is a species belonging to the family Argidae subfamily Arginae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge ochropus has left across the world's sequence archives.

At a glance

DNA specimens46

BINs5

Marker genes1

eDNA detections30

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 106 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Cmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Gvariable

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

38Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Cmostly conserved

45Tmostly conserved

48Cmostly conserved

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

55Tmostly conserved

58Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Cvariable

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

74Cmostly conserved

75Tmostly conserved

76Tmostly conserved

77Amostly conserved

78Gmostly conserved

79Amostly conserved

80Tmostly conserved

81Cmostly conserved

82Tmostly conserved

84Tmostly conserved

85Amostly conserved

86Gmostly conserved

87Gmostly conserved

88Tmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Amostly conserved

100Amostly conserved

127Tvariable

184Amostly conserved

202Amostly conserved

206Tmostly conserved

217Avariable

220Gvariable

229Amostly conserved

235Tmostly conserved

238Gmostly conserved

274Cmostly conserved

287Cvariable

310Cmostly conserved

322Amostly conserved

343Cmostly conserved

346Amostly conserved

347Tmostly conserved

367Tmostly conserved

373Avariable

385Cmostly conserved

407Cmostly conserved

430Avariable

433Amostly conserved

445Tmostly conserved

451Tmostly conserved

478Tvariable

479Tmostly conserved

490Cmostly conserved

542Tvariable

544Avariable

547Tmostly conserved

565Amostly conserved

616Cvariable

625Avariable

628Gmostly conserved

631Amostly conserved

634Tmostly conserved

641Tmostly conserved

AACATTATATTTCATTTTTGGGATTTGATCAGGAATAATAGGACTTTCTTTTAGTATAATTATTCGCACAGAACTTAGATCTGTAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.0%

Haplotypes9

BINs5

Most divergent pair4.6%

EuropeAsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge cyanocroceasame genus8.8%Arge annulatasame genus9.8%Arge fuscipessame genus9.9%Arge macleayisame genus9.9%Arge ustulatasame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Arge ochropus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈239 642 833 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Arge ochropus0.24 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness91.8% BUSCO

08Occurrence & distribution

Record type5 204 records

Wild obs. + sensor4 132

Museum / vouchered1 071

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO12 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 1 680≤1 km 731≤10 km 830>10 km 149

3 390 georeferenced · 742 without coordinates

Open the mapobservation + sensor4 132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 90≤1 km 170≤10 km 634>10 km 37

931 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence1 071

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	670
NHMOlocation not on record	115
Zürich, CH	33
BioFokuslocation not on record	28
Provincia di Livornolocation not on record	27
ZMAAlocation not on record	17
ZSMlocation not on record	16
Tilburg, NL	13
Institute of Zoology Slovak Academy of Scienceslocation not on record	11
Oulu, FI	9
Muzeum Górnośląskie w Bytomiulocation not on record	8
Bavarian State Collection of Zoologylocation not on record	7
SLU Artdatabankenlocation not on record	6
Tartu, EE	5
neflocation not on record	4
MZLUlocation not on record	3
DFFW2018location not on record	3
University of Oululocation not on record	3
NEFlocation not on record	3
UGRlocation not on record	3
Champaign, US	2
Philadelphia, US	2
Natural History Museum Rotterdamlocation not on record	2
Ghent, BE	2
Nijmegen, NL	2
Vancouver, CA	1
Bonn, DE	1
Banyoles, ES	1
Ugentlocation not on record	1
OSUClocation not on record	1
Gothenburg, SE	1

31 institutions · 1 000 of 1 071 vouchered records shown · 71 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA30 detections

Where the DNA of Arge ochropus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map12 countries0

decorative roseMixed habitatcoastal dunes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 15.6–20.7

Seasonal swing summer↔winter19.4 °C

Max temp (day)21.2 °C 18.5–25.2

Min temp (night)14.3 °C 9.70–16.4

Precipitation71.8 mm/mo 52.3–98.0

Air humidity59.2 % 56.6–62.5

Moisture balance-43.2 mm/mo

Vapour deficit809 Pa 711–1,047

Wind speed2.90 m/s

Cloud cover39.2 % 32.2–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arge ochropus

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 204 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 204 records