Ardis sulcata

(Cameron, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Ardis

At a glance

Occurrence records51

Data sources5

Biological traits0

DNA specimens7

eDNA detections0

Sources5 archives

Databases and archives Ardis sulcata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

DNA & barcodingBOLD7 specimens

01Narrative

Ardis sulcata is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1882 door Cameron.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardis sulcata has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.58%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

74Cvariable

184Avariable

214Avariable

310Cvariable

565Tmostly conserved

616Cvariable

AACTTTATATTTTATTTTTGGATTTTGATCAGGCATATTAGGTATATCATTTAGAATACTAATCCGAATAGAACTAGGTATACCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ametastegia tenerasame family8.7%Stethomostus fuliginosussame family9.6%Periclista inaequidenssame family10.3%Ametastegia pulchellasame family10.8%Ametastegia pallipessame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor38

Museum / vouchered13

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 24≤1 km 8≤10 km 1

33 georeferenced · 5 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	3
Institute of Zoology Slovak Academy of Scienceslocation not on record	3
Zürich, CH	1
Bavarian State Collection of Zoologylocation not on record	1
NCMGlocation not on record	1

5 institutions · 9 of 13 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)