Arctosa rubicunda

(Keyserling, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Arctosa

At a glance

Occurrence records282

Data sources8

Biological traits3

DNA specimens27

eDNA detections29

Sources8 archives

Databases and archives Arctosa rubicunda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility282 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF282 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD27 specimens

01Narrative

Arctosa rubicunda is a species of wolf spider in the family Lycosidae. It is found in the USA and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀10·♂7.95 mm

Cephalothorax length♀4.77·♂4.24 mm

Cephalothorax width♀3.4·♂2.92 mm

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctosa rubicunda has left across the world's sequence archives.

At a glance

DNA specimens27

BINs4

Marker genes1

eDNA detections29

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

1Gmostly conserved

7Amostly conserved

10Tmostly conserved

16Gvariable

19Tmostly conserved

25Tmostly conserved

43Tmostly conserved

55Cmostly conserved

58Amostly conserved

61Amostly conserved

67Amostly conserved

79Amostly conserved

88Amostly conserved

94Cvariable

97Amostly conserved

112Gmostly conserved

124Amostly conserved

139Tmostly conserved

148Gmostly conserved

151Tmostly conserved

163Avariable

169Amostly conserved

173Cmostly conserved

181Tmostly conserved

196Gmostly conserved

197Tmostly conserved

199Amostly conserved

211Gvariable

214Amostly conserved

217Gmostly conserved

244Amostly conserved

256Tmostly conserved

263Cvariable

265Amostly conserved

266Cvariable

278Tvariable

284Tmostly conserved

292Amostly conserved

304Gvariable

305Gmostly conserved

316Amostly conserved

322Gmostly conserved

328Amostly conserved

343Tmostly conserved

349Amostly conserved

364Gmostly conserved

369Tmostly conserved

379Tmostly conserved

380Amostly conserved

382Gmostly conserved

421Cmostly conserved

430Gmostly conserved

433Amostly conserved

436Amostly conserved

469Amostly conserved

473Amostly conserved

478Tmostly conserved

479Amostly conserved

481Amostly conserved

487Gmostly conserved

492Amostly conserved

493Amostly conserved

499Tvariable

508Tmostly conserved

511Gmostly conserved

514Gvariable

532Gmostly conserved

538Amostly conserved

541Amostly conserved

556Gmostly conserved

574Amostly conserved

577Amostly conserved

578Cmostly conserved

580Amostly conserved

583Gmostly conserved

586Tmostly conserved

589Cmostly conserved

616Cvariable

628Gvariable

631Avariable

GACTTTATATTTAATGTTTGGTGTTTGATCGGCTATAATAGGTACTGCTATAAGCGTATTAATTCGAATGGAATTAGGACATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes7

BINs4

Most divergent pair9.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctosa emertonisame genus8.2%Alopecosa taeniatasame family9.1%Alopecosa aculeatasame family9.3%Alopecosa pinetorumsame family9.9%Alopecosa pulverulentasame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type282 records

Wild obs. + sensor111

Museum / vouchered171

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 58≤1 km 11≤10 km 8>10 km 18

95 georeferenced · 16 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	45
Cambridge, US	29
WIlocation not on record	25
University of Alberta Museums (UAM)location not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	13
Chicago, US	13
Ohio State University Acarology Laboratorylocation not on record	5
Espace pour la vielocation not on record	2
Royal Saskatchewan Museumlocation not on record	1
Frankfurt am Main	1

10 institutions · 149 of 171 vouchered records shown · 22 without an institution code

09Environmental DNA29 detections

Where the DNA of Arctosa rubicunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

BogOpen mesic1. Forest & Woodland | 5. Wetlands (inland)ForestWetlandOpen wet

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 8.50–17.8

Seasonal swing summer↔winter27.7 °C

Max temp (day)19.4 °C 14.5–22.0

Min temp (night)8.70 °C 3.20–14.6

Precipitation63.4 mm/mo 45.8–95.0

Air humidity55.8 % 52.1–60.1

Moisture balance-63.5 mm/mo -85.9–-24.2

Vapour deficit699 Pa 446–854

Wind speed2.70 m/s 1.90–4.50

Cloud cover41.4 % 36.8–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)