Archips oporana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Archips

At a glance

Occurrence records5 195

Data sources10

Biological traits2

DNA specimens52

eDNA detections60

Sources10 archives

Databases and archives Archips oporana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 195 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 195 records

Environmental DNA3 datasets · 12 countries60 detections

DNA & barcodingBOLD52 specimens

Genome at a glanceGoaT · NCBI≈619 Mbp

01Narrative

Archips oporana, also known as the pine tortrix or spruce tortrix is a moth of the family Tortricidae, found in Asia and Europe. It was first described by Carl Linnaeus in 1758.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archips oporana has left across the world's sequence archives.

At a glance

DNA specimens52

BINs3

Marker genes1

eDNA detections60

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

67Amostly conserved

68Gmostly conserved

85Amostly conserved

100Cmostly conserved

124Tmostly conserved

160Amostly conserved

172Cmostly conserved

175Amostly conserved

193Cmostly conserved

197Cmostly conserved

202Cmostly conserved

238Cmostly conserved

274Tmostly conserved

284Tmostly conserved

379Amostly conserved

448Cmostly conserved

457Cmostly conserved

562Cmostly conserved

568Cmostly conserved

578Tmostly conserved

622Tmostly conserved

625Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGAACTTCTTTAAGAATAATAATTCGAGCTGAACTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes6

BINs3

Most divergent pair0.61%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Archips betulanasame genus6.7%Aphelia ochreanasame family7.4%Archips dissitanasame genus7.6%Ericodesma isochroasame family7.6%Tortrix technicasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Archips oporana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈618 656 821 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Archips oporana0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.2% BUSCO

08Occurrence & distribution

Record type5 195 records

Wild obs. + sensor4 335

Museum / vouchered707

Other153

Range

Area of Occupancy AOO8 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 1 611≤1 km 1 117≤10 km 1 199>10 km 13

3 940 georeferenced · 395 without coordinates

Open the mapobservation + sensor4 335

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 211≤1 km 228≤10 km 100>10 km 2

541 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence707

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	186
Provincia di Livornolocation not on record	80
NHMOlocation not on record	67
Tartu, EE	44
Chiba, JP	32
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	31
SLU Artdatabankenlocation not on record	31
Kuopio, FI	22
Salzburg, AT	21
Philadelphia, US	10
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	9
Sagamihara, JP	8
NTNU-VMlocation not on record	7
Rovaniemi, FI	7
Durban Natural Science Museumlocation not on record	6
Tallinn, EE	6
Zürich, CH	6
Stockholm, SE	5
KIRMlocation not on record	5
KOMlocation not on record	5
Muzeum Górnośląskie w Bytomiulocation not on record	4
Nijmegen, NL	4
MZLUlocation not on record	4
HUNMlocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Iwate Prefectural Museumlocation not on record	2
NMBU:MINAlocation not on record	2
DABUHlocation not on record	2
Hiwa Museum of Natural Historylocation not on record	2
Kawasaki Shi Tama Ku, JP	1
NTNU University Museum, Department of Natural Historylocation not on record	1
ZSMlocation not on record	1
University of Kaiserslauternlocation not on record	1
ZMAAlocation not on record	1
National Institute of Biological Resourceslocation not on record	1

36 institutions · 625 of 707 vouchered records shown · 82 without an institution code

09Environmental DNA60 detections

Where the DNA of Archips oporana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys3

Countries12

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map12 countries0

Grassland43UrbanGarden centre

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 12.8–21.7

Seasonal swing summer↔winter20.8 °C

Max temp (day)19.2 °C 15.7–25.7

Min temp (night)11.5 °C 7.50–18.0

Precipitation92.8 mm/mo 58.8–218

Air humidity61.0 % 57.5–68.3

Moisture balance-8.10 mm/mo -56.7–111

Vapour deficit698 Pa 531–989

Wind speed2.90 m/s 1.90–4.20

Cloud cover41.3 % 35.3–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archips oporana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 195 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 195 records