Arboridia pusilla

(Ribaut, 1936) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Arboridia

At a glance

Occurrence records6

Data sources5

Biological traits0

DNA specimens133

eDNA detections220

Sources5 archives

Databases and archives Arboridia pusilla's data was compiled from.

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI220 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics133 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF6 records

Environmental DNA3 datasets · 9 countries220 detections

DNA & barcodingBOLD133 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding133 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arboridia pusilla has left across the world's sequence archives.

At a glance

DNA specimens133

BINs2

Marker genes1

eDNA detections220

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus132 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

60Tmostly conserved

84Tmostly conserved

153Tmostly conserved

183Tmostly conserved

216Tvariable

312Amostly conserved

318Amostly conserved

333Cmostly conserved

336Cmostly conserved

399Tvariable

444Cmostly conserved

447Tmostly conserved

475Tmostly conserved

492Tmostly conserved

504Gvariable

537Amostly conserved

567Cmostly conserved

601Tmostly conserved

606Cmostly conserved

615Cvariable

618Cvariable

ATATATTTCATTTTCGGGATTTGGGCAGGTATAGTAGGTATAATACTAAGAATACTTATTCGAATTGAATTAGCCCAGCCAGGTGCATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes13

BINs2

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arboridia parvulasame genus3.4%Arboridia kakogawanasame genus11.9%Hymetta balteatasame family14.9%Erythridula wysongisame family14.9%Zygina ordinariasame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor1

Museum / vouchered5

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
BioFokuslocation not on record	4
Norwegian Institute for Nature Researchlocation not on record	1

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA220 detections

Where the DNA of Arboridia pusilla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found220

Studies independent surveys3

Countries9

Verifiable raw sequence linked66

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 220 detections have coordinates

Open the map9 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…1.1. Boreal Forest|1. Forest & WoodlandUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 9.20–18.2

Seasonal swing summer↔winter18.5 °C

Max temp (day)19.4 °C 13.6–22.6

Min temp (night)11.4 °C 5.50–14.2

Precipitation71.6 mm/mo 49.7–121

Air humidity60.0 % 56.1–63.0

Moisture balance-6.90 mm/mo -61.4–21.6

Vapour deficit696 Pa 465–925

Wind speed2.40 m/s 2.10–3.70

Cloud cover41.0 % 34.5–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 219 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)