Arboridia parvula

(Boheman, 1845) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Arboridia

At a glance

Occurrence records265

Data sources4

Biological traits2

DNA specimens48

eDNA detections0

Sources4 archives

Databases and archives Arboridia parvula's data was compiled from.

GBIFGlobal Biodiversity Information Facility265 records↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF265 records

DNA & barcodingBOLD48 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arboridia parvula has left across the world's sequence archives.

At a glance

DNA specimens48

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.01%

Haplotypes2

BIN1

Most divergent pair0.31%

CTATATATTTCATTTTCGGGATTTGGGCAGGTATAGTAGGTATAATACTAAGAATACTTATTCGAATTGAACTAGCCCAGCCAGGGGCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arboridia pusillasame genus3.4%Arboridia kakogawanasame genus12.5%Illinigina illinoiensissame family13.9%Erythridula wysongisame family14.4%Anzygina honiloasame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type265 records

Wild obs. + sensor223

Museum / vouchered41

Other1

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 89≤1 km 39≤10 km 25

153 georeferenced · 70 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 3

14 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	11
Philadelphia, US	11
BioFokuslocation not on record	3
Metsähallituslocation not on record	3
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
SLU Artdatabankenlocation not on record	1

7 institutions · 31 of 41 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)